Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2001615..2001760 | Replicon | chromosome |
| Accession | NZ_CP069381 | ||
| Organism | Salmonella enterica strain GSJ/2016-Sal-016 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2001655..2001758 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2001615..2001760 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| JSR10_RS09620 | 1998041..1998739 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| JSR10_RS09625 | 1998763..1999419 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| JSR10_RS09630 | 1999527..1999757 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| JSR10_RS09635 | 1999895..2000269 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| JSR10_RS09640 | 2000270..2001145 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| JSR10_RS09645 | 2001162..2001515 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2001615..2001760 | - | 146 | - | - | Antitoxin |
| - | 2001655..2001758 | + | 104 | - | - | Toxin |
| JSR10_RS09650 | 2001889..2002812 | - | 924 | Protein_1887 | tyrosine-type recombinase/integrase | - |
| JSR10_RS09655 | 2003076..2003537 | - | 462 | Protein_1888 | DNA breaking-rejoining protein | - |
| JSR10_RS09660 | 2003526..2003717 | + | 192 | Protein_1889 | glycoside hydrolase family 19 protein | - |
| JSR10_RS09665 | 2003771..2004304 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| JSR10_RS09670 | 2004561..2004728 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| JSR10_RS09675 | 2004793..2004981 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| JSR10_RS09680 | 2005036..2005296 | + | 261 | Protein_1893 | DUF1441 family protein | - |
| JSR10_RS09685 | 2005298..2005513 | + | 216 | Protein_1894 | shikimate transporter | - |
| JSR10_RS09690 | 2005511..2005855 | + | 345 | Protein_1895 | macro domain-containing protein | - |
| JSR10_RS09695 | 2005865..2006335 | + | 471 | Protein_1896 | tail fiber assembly protein | - |
| JSR10_RS09700 | 2006432..2006632 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 1995955..2034279 | 38324 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T190273 NZ_CP069381:2001655-2001758 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT190273 NZ_CP069381:c2001760-2001615 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
