Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2583607..2583752 | Replicon | chromosome |
Accession | NZ_CP068696 | ||
Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP16345 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2583647..2583750 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2583607..2583752 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
JKV46_RS12700 | 2580033..2580731 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
JKV46_RS12705 | 2580755..2581411 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
JKV46_RS12710 | 2581519..2581749 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
JKV46_RS12715 | 2581887..2582261 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
JKV46_RS12720 | 2582262..2583137 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
JKV46_RS12725 | 2583154..2583507 | + | 354 | WP_000722368.1 | YebY family protein | - |
- | 2583607..2583752 | - | 146 | - | - | Antitoxin |
- | 2583647..2583750 | + | 104 | - | - | Toxin |
JKV46_RS12730 | 2583881..2584804 | - | 924 | Protein_2477 | tyrosine-type recombinase/integrase | - |
JKV46_RS12735 | 2585068..2585529 | - | 462 | Protein_2478 | DNA breaking-rejoining protein | - |
JKV46_RS12740 | 2585518..2585709 | + | 192 | Protein_2479 | glycoside hydrolase family 19 protein | - |
JKV46_RS12745 | 2585763..2586296 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
JKV46_RS12750 | 2586553..2586720 | - | 168 | WP_000789530.1 | lytic enzyme | - |
JKV46_RS12755 | 2586785..2586973 | - | 189 | WP_001521334.1 | hypothetical protein | - |
JKV46_RS12760 | 2587028..2587288 | + | 261 | Protein_2483 | DUF1441 family protein | - |
JKV46_RS12765 | 2587503..2587847 | + | 345 | Protein_2484 | macro domain-containing protein | - |
JKV46_RS12770 | 2587857..2588327 | + | 471 | Protein_2485 | tail fiber assembly protein | - |
JKV46_RS12775 | 2588424..2588624 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
inside | Prophage | - | sopE2 | 2576270..2616256 | 39986 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T187605 NZ_CP068696:2583647-2583750 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT187605 NZ_CP068696:c2583752-2583607 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG