Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 1968708..1968853 Replicon chromosome
Accession NZ_CP067397
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain LB5000

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 1968710..1968813 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 1968708..1968853 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
JJB81_RS09605 1963836..1964036 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
JJB81_RS23775 1964133..1964603 - 471 Protein_1885 tail fiber assembly protein -
JJB81_RS23780 1964613..1964957 - 345 Protein_1886 macro domain-containing protein -
JJB81_RS09615 1965172..1965432 - 261 Protein_1887 DUF1441 family protein -
JJB81_RS09620 1965487..1965675 + 189 WP_001521334.1 hypothetical protein -
JJB81_RS09625 1965740..1965907 + 168 WP_000789530.1 lytic enzyme -
JJB81_RS09630 1966164..1966697 - 534 WP_001050882.1 DUF2514 domain-containing protein -
JJB81_RS09635 1966751..1966942 - 192 Protein_1891 glycoside hydrolase family 19 protein -
JJB81_RS23785 1966931..1967392 + 462 Protein_1892 DNA breaking-rejoining protein -
JJB81_RS09645 1967656..1968579 + 924 Protein_1893 tyrosine-type recombinase/integrase -
- 1968708..1968853 + 146 - - Antitoxin
- 1968710..1968813 - 104 - - Toxin
JJB81_RS09650 1968953..1969306 - 354 WP_000722368.1 YebY family protein -
JJB81_RS09655 1969323..1970198 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
JJB81_RS09660 1970199..1970573 - 375 WP_000168393.1 CopC domain-containing protein YobA -
JJB81_RS09665 1970711..1970941 + 231 WP_000856224.1 DNA polymerase III subunit theta -
JJB81_RS09670 1971049..1971705 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
JJB81_RS09675 1971729..1972427 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 1936204..1974513 38309


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T186245 NZ_CP067397:c1968813-1968710 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT186245 NZ_CP067397:1968708-1968853 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References