Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1968708..1968853 | Replicon | chromosome |
| Accession | NZ_CP067397 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain LB5000 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1968710..1968813 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1968708..1968853 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| JJB81_RS09605 | 1963836..1964036 | + | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
| JJB81_RS23775 | 1964133..1964603 | - | 471 | Protein_1885 | tail fiber assembly protein | - |
| JJB81_RS23780 | 1964613..1964957 | - | 345 | Protein_1886 | macro domain-containing protein | - |
| JJB81_RS09615 | 1965172..1965432 | - | 261 | Protein_1887 | DUF1441 family protein | - |
| JJB81_RS09620 | 1965487..1965675 | + | 189 | WP_001521334.1 | hypothetical protein | - |
| JJB81_RS09625 | 1965740..1965907 | + | 168 | WP_000789530.1 | lytic enzyme | - |
| JJB81_RS09630 | 1966164..1966697 | - | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| JJB81_RS09635 | 1966751..1966942 | - | 192 | Protein_1891 | glycoside hydrolase family 19 protein | - |
| JJB81_RS23785 | 1966931..1967392 | + | 462 | Protein_1892 | DNA breaking-rejoining protein | - |
| JJB81_RS09645 | 1967656..1968579 | + | 924 | Protein_1893 | tyrosine-type recombinase/integrase | - |
| - | 1968708..1968853 | + | 146 | - | - | Antitoxin |
| - | 1968710..1968813 | - | 104 | - | - | Toxin |
| JJB81_RS09650 | 1968953..1969306 | - | 354 | WP_000722368.1 | YebY family protein | - |
| JJB81_RS09655 | 1969323..1970198 | - | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| JJB81_RS09660 | 1970199..1970573 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| JJB81_RS09665 | 1970711..1970941 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| JJB81_RS09670 | 1971049..1971705 | + | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| JJB81_RS09675 | 1971729..1972427 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 1936204..1974513 | 38309 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T186245 NZ_CP067397:c1968813-1968710 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT186245 NZ_CP067397:1968708-1968853 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
