Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 1967972..1968117 Replicon chromosome
Accession NZ_CP067091
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain ER3625

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 1967974..1968077 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 1967972..1968117 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
JJB80_RS09610 1963100..1963300 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
JJB80_RS23800 1963397..1963867 - 471 Protein_1886 tail fiber assembly protein -
JJB80_RS23805 1963877..1964221 - 345 Protein_1887 macro domain-containing protein -
JJB80_RS09620 1964436..1964696 - 261 Protein_1888 DUF1441 family protein -
JJB80_RS09625 1964751..1964939 + 189 WP_001521334.1 hypothetical protein -
JJB80_RS09630 1965004..1965171 + 168 WP_000789530.1 lytic enzyme -
JJB80_RS09635 1965428..1965961 - 534 WP_001050882.1 DUF2514 domain-containing protein -
JJB80_RS09640 1966015..1966206 - 192 Protein_1892 glycoside hydrolase family 19 protein -
JJB80_RS23810 1966195..1966656 + 462 Protein_1893 DNA breaking-rejoining protein -
JJB80_RS09650 1966920..1967843 + 924 Protein_1894 tyrosine-type recombinase/integrase -
- 1967972..1968117 + 146 - - Antitoxin
- 1967974..1968077 - 104 - - Toxin
JJB80_RS09655 1968217..1968570 - 354 WP_000722368.1 YebY family protein -
JJB80_RS09660 1968587..1969462 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
JJB80_RS09665 1969463..1969837 - 375 WP_000168393.1 CopC domain-containing protein YobA -
JJB80_RS09670 1969975..1970205 + 231 WP_000856224.1 DNA polymerase III subunit theta -
JJB80_RS09675 1970313..1970969 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
JJB80_RS09680 1970993..1971691 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 1935468..1971691 36223


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T185716 NZ_CP067091:c1968077-1967974 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT185716 NZ_CP067091:1967972-1968117 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References