Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 4021443..4021588 Replicon chromosome
Accession NZ_CP047555
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10112

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 4021445..4021548 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 4021443..4021588 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
DXN18_RS19585 4016571..4016771 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
DXN18_RS19590 4016868..4017338 - 471 Protein_3819 tail fiber assembly protein -
DXN18_RS19595 4017348..4017692 - 345 Protein_3820 macro domain-containing protein -
DXN18_RS19600 4017907..4018167 - 261 Protein_3821 DUF1441 family protein -
DXN18_RS19605 4018222..4018410 + 189 WP_001521334.1 hypothetical protein -
DXN18_RS19610 4018475..4018642 + 168 WP_000789530.1 lytic enzyme -
DXN18_RS19615 4018899..4019432 - 534 WP_001050882.1 DUF2514 domain-containing protein -
DXN18_RS19620 4019486..4019677 - 192 Protein_3825 glycoside hydrolase family 19 protein -
DXN18_RS19625 4019666..4020127 + 462 Protein_3826 DNA breaking-rejoining protein -
DXN18_RS19630 4020391..4021314 + 924 Protein_3827 tyrosine-type recombinase/integrase -
- 4021443..4021588 + 146 - - Antitoxin
- 4021445..4021548 - 104 - - Toxin
DXN18_RS19635 4021688..4022041 - 354 WP_000722368.1 YebY family protein -
DXN18_RS19640 4022058..4022933 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
DXN18_RS19645 4022934..4023308 - 375 WP_000168393.1 CopC domain-containing protein YobA -
DXN18_RS19650 4023446..4023676 + 231 WP_000856224.1 DNA polymerase III subunit theta -
DXN18_RS19655 4023784..4024440 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
DXN18_RS19660 4024464..4025162 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 3988931..4028925 39994


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T146703 NZ_CP047555:c4021548-4021445 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT146703 NZ_CP047555:4021443-4021588 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References