Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 4021443..4021588 | Replicon | chromosome |
| Accession | NZ_CP047555 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10112 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 4021445..4021548 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 4021443..4021588 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DXN18_RS19585 | 4016571..4016771 | + | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
| DXN18_RS19590 | 4016868..4017338 | - | 471 | Protein_3819 | tail fiber assembly protein | - |
| DXN18_RS19595 | 4017348..4017692 | - | 345 | Protein_3820 | macro domain-containing protein | - |
| DXN18_RS19600 | 4017907..4018167 | - | 261 | Protein_3821 | DUF1441 family protein | - |
| DXN18_RS19605 | 4018222..4018410 | + | 189 | WP_001521334.1 | hypothetical protein | - |
| DXN18_RS19610 | 4018475..4018642 | + | 168 | WP_000789530.1 | lytic enzyme | - |
| DXN18_RS19615 | 4018899..4019432 | - | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| DXN18_RS19620 | 4019486..4019677 | - | 192 | Protein_3825 | glycoside hydrolase family 19 protein | - |
| DXN18_RS19625 | 4019666..4020127 | + | 462 | Protein_3826 | DNA breaking-rejoining protein | - |
| DXN18_RS19630 | 4020391..4021314 | + | 924 | Protein_3827 | tyrosine-type recombinase/integrase | - |
| - | 4021443..4021588 | + | 146 | - | - | Antitoxin |
| - | 4021445..4021548 | - | 104 | - | - | Toxin |
| DXN18_RS19635 | 4021688..4022041 | - | 354 | WP_000722368.1 | YebY family protein | - |
| DXN18_RS19640 | 4022058..4022933 | - | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| DXN18_RS19645 | 4022934..4023308 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| DXN18_RS19650 | 4023446..4023676 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| DXN18_RS19655 | 4023784..4024440 | + | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| DXN18_RS19660 | 4024464..4025162 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 3988931..4028925 | 39994 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T146703 NZ_CP047555:c4021548-4021445 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT146703 NZ_CP047555:4021443-4021588 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG