Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2143795..2143940 | Replicon | chromosome |
| Accession | NZ_CP047550 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10057 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2143835..2143938 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2143795..2143940 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DXN07_RS10465 | 2140221..2140919 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| DXN07_RS10470 | 2140943..2141599 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| DXN07_RS10475 | 2141707..2141937 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| DXN07_RS10480 | 2142075..2142449 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| DXN07_RS10485 | 2142450..2143325 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| DXN07_RS10490 | 2143342..2143695 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2143795..2143940 | - | 146 | - | - | Antitoxin |
| - | 2143835..2143938 | + | 104 | - | - | Toxin |
| DXN07_RS10495 | 2144069..2144992 | - | 924 | Protein_2058 | tyrosine-type recombinase/integrase | - |
| DXN07_RS10500 | 2145256..2145717 | - | 462 | Protein_2059 | DNA breaking-rejoining protein | - |
| DXN07_RS10505 | 2145706..2145897 | + | 192 | Protein_2060 | glycoside hydrolase family 19 protein | - |
| DXN07_RS10510 | 2145951..2146484 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| DXN07_RS10515 | 2146741..2146908 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| DXN07_RS10520 | 2146973..2147161 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| DXN07_RS10525 | 2147216..2147476 | + | 261 | Protein_2064 | DUF1441 family protein | - |
| DXN07_RS10530 | 2147691..2148035 | + | 345 | Protein_2065 | macro domain-containing protein | - |
| DXN07_RS10535 | 2148045..2148515 | + | 471 | Protein_2066 | tail fiber assembly protein | - |
| DXN07_RS10540 | 2148612..2148812 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2140221..2168797 | 28576 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T146643 NZ_CP047550:2143835-2143938 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT146643 NZ_CP047550:c2143940-2143795 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
