Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2133875..2134020 | Replicon | chromosome |
| Accession | NZ_CP047531 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10484 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2133915..2134018 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2133875..2134020 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DXN09_RS10405 | 2130301..2130999 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| DXN09_RS10410 | 2131023..2131679 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| DXN09_RS10415 | 2131787..2132017 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| DXN09_RS10420 | 2132155..2132529 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| DXN09_RS10425 | 2132530..2133405 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| DXN09_RS10430 | 2133422..2133775 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2133875..2134020 | - | 146 | - | - | Antitoxin |
| - | 2133915..2134018 | + | 104 | - | - | Toxin |
| DXN09_RS10435 | 2134149..2135072 | - | 924 | Protein_2046 | tyrosine-type recombinase/integrase | - |
| DXN09_RS10440 | 2135336..2135797 | - | 462 | Protein_2047 | DNA breaking-rejoining protein | - |
| DXN09_RS10445 | 2135786..2135977 | + | 192 | Protein_2048 | glycoside hydrolase family 19 protein | - |
| DXN09_RS10450 | 2136031..2136564 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| DXN09_RS10455 | 2136821..2136988 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| DXN09_RS10460 | 2137053..2137241 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| DXN09_RS10465 | 2137296..2137556 | + | 261 | Protein_2052 | DUF1441 family protein | - |
| DXN09_RS10470 | 2137771..2138115 | + | 345 | Protein_2053 | macro domain-containing protein | - |
| DXN09_RS10475 | 2138125..2138595 | + | 471 | Protein_2054 | tail fiber assembly protein | - |
| DXN09_RS10480 | 2138692..2138892 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2126538..2166532 | 39994 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T146438 NZ_CP047531:2133915-2134018 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT146438 NZ_CP047531:c2134020-2133875 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
