Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2852221..2852366 Replicon chromosome
Accession NZ_CP047522
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF11216

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2852223..2852326 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2852221..2852366 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
DXN15_RS13930 2847349..2847549 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
DXN15_RS13935 2847646..2848116 - 471 Protein_2708 tail fiber assembly protein -
DXN15_RS13940 2848126..2848470 - 345 Protein_2709 macro domain-containing protein -
DXN15_RS13945 2848685..2848945 - 261 Protein_2710 DUF1441 family protein -
DXN15_RS13950 2849000..2849188 + 189 WP_001521334.1 hypothetical protein -
DXN15_RS13955 2849253..2849420 + 168 WP_000789530.1 lytic enzyme -
DXN15_RS13960 2849677..2850210 - 534 WP_001050882.1 DUF2514 domain-containing protein -
DXN15_RS13965 2850264..2850455 - 192 Protein_2714 glycoside hydrolase family 19 protein -
DXN15_RS13970 2850444..2850905 + 462 Protein_2715 DNA breaking-rejoining protein -
DXN15_RS13975 2851169..2852092 + 924 Protein_2716 tyrosine-type recombinase/integrase -
- 2852221..2852366 + 146 - - Antitoxin
- 2852223..2852326 - 104 - - Toxin
DXN15_RS13980 2852466..2852819 - 354 WP_000722368.1 YebY family protein -
DXN15_RS13985 2852836..2853711 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
DXN15_RS13990 2853712..2854086 - 375 WP_000168393.1 CopC domain-containing protein YobA -
DXN15_RS13995 2854224..2854454 + 231 WP_000856224.1 DNA polymerase III subunit theta -
DXN15_RS14000 2854562..2855218 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
DXN15_RS14005 2855242..2855940 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2819709..2859703 39994


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T146337 NZ_CP047522:c2852326-2852223 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT146337 NZ_CP047522:2852221-2852366 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References