Detailed information    

insolico Bioinformatically predicted

Overview


Name   pilB   Type   Machinery gene
Locus tag   R5577_RS15580 Genome accession   NZ_CP137539
Coordinates   3657635..3657754 (-) Length   39 a.a.
NCBI ID   WP_230440136.1    Uniprot ID   -
Organism   Xanthomonas euvesicatoria strain T0319-01     
Function   power the assembly of type IV pilus (predicted from homology)   
DNA binding and uptake

Related MGE


Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type MGE coordinates Gene coordinates Relative position Distance (bp)
ICE 3642692..3712405 3657635..3657754 within 0


Gene organization within MGE regions


Location: 3642692..3712405
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  R5577_RS15505 (R5577_15505) - 3643766..3644200 (-) 435 WP_031423856.1 thiol-disulfide oxidoreductase DCC family protein -
  R5577_RS15510 (R5577_15510) - 3644187..3644711 (-) 525 WP_031423858.1 DUF4166 domain-containing protein -
  R5577_RS15515 (R5577_15515) pgeF 3644714..3645526 (-) 813 WP_109290735.1 peptidoglycan editing factor PgeF -
  R5577_RS15520 (R5577_15520) rluD 3645528..3646523 (-) 996 WP_008577792.1 23S rRNA pseudouridine(1911/1915/1917) synthase RluD -
  R5577_RS15525 (R5577_15525) - 3646645..3647527 (+) 883 Protein_3042 outer membrane protein assembly factor BamD -
  R5577_RS15530 (R5577_15530) - 3647809..3648786 (+) 978 WP_219930962.1 hypothetical protein -
  R5577_RS15535 (R5577_15535) - 3648805..3650460 (-) 1656 WP_317720309.1 NAD+ synthase -
  R5577_RS15540 (R5577_15540) - 3650460..3650762 (-) 303 WP_008577789.1 type II toxin-antitoxin system RelE/ParE family toxin -
  R5577_RS15545 (R5577_15545) - 3650766..3651110 (-) 345 WP_008577787.1 ribbon-helix-helix domain-containing protein -
  R5577_RS15550 (R5577_15550) sucD 3651281..3652156 (-) 876 WP_029820064.1 succinate--CoA ligase subunit alpha -
  R5577_RS15555 (R5577_15555) sucC 3652181..3653350 (-) 1170 WP_317718950.1 ADP-forming succinate--CoA ligase subunit beta -
  R5577_RS15560 (R5577_15560) - 3653581..3655194 (+) 1614 WP_317718951.1 HAMP domain-containing sensor histidine kinase -
  R5577_RS15565 (R5577_15565) pilR 3655461..3656915 (+) 1455 WP_317718952.1 sigma-54 dependent transcriptional regulator Regulator
  R5577_RS15570 (R5577_15570) - 3657136..3657255 (-) 120 WP_317718953.1 pilus assembly protein -
  R5577_RS15575 (R5577_15575) pilB 3657384..3657503 (-) 120 WP_029220459.1 hypothetical protein Machinery gene
  R5577_RS15580 (R5577_15580) pilB 3657635..3657754 (-) 120 WP_230440136.1 pilus assembly protein Machinery gene
  R5577_RS15585 (R5577_15585) pilB 3657884..3659620 (-) 1737 WP_317718954.1 type IV-A pilus assembly ATPase PilB Machinery gene
  R5577_RS15590 (R5577_15590) - 3659662..3660081 (-) 420 WP_317718955.1 pilin -
  R5577_RS15595 (R5577_15595) - 3660135..3660554 (-) 420 WP_317718956.1 pilin -
  R5577_RS15600 (R5577_15600) pilC 3660931..3662190 (+) 1260 WP_317718957.1 type II secretion system F family protein Machinery gene
  R5577_RS15605 (R5577_15605) - 3662197..3663060 (+) 864 WP_003491180.1 A24 family peptidase -
  R5577_RS15610 (R5577_15610) coaE 3663074..3663685 (+) 612 WP_109290722.1 dephospho-CoA kinase -
  R5577_RS15615 (R5577_15615) - 3664362..3667259 (+) 2898 Protein_3060 DUF6531 domain-containing protein -
  R5577_RS15620 (R5577_15620) - 3667326..3668428 (+) 1103 WP_094030629.1 IS3 family transposase -
  R5577_RS15625 (R5577_15625) - 3668747..3669029 (+) 283 Protein_3062 SymE family type I addiction module toxin -
  R5577_RS15630 (R5577_15630) - 3669132..3670466 (-) 1335 WP_011348346.1 HAMP domain-containing sensor histidine kinase -
  R5577_RS15635 (R5577_15635) - 3670459..3671136 (-) 678 WP_003490678.1 response regulator transcription factor -
  R5577_RS15640 (R5577_15640) - 3671162..3671605 (-) 444 WP_008576857.1 hypothetical protein -
  R5577_RS15645 (R5577_15645) rimK 3671814..3672731 (-) 918 WP_008576854.1 30S ribosomal protein S6--L-glutamate ligase -
  R5577_RS15650 (R5577_15650) glgX 3673202..3675334 (+) 2133 WP_109291632.1 glycogen debranching protein GlgX -
  R5577_RS15655 (R5577_15655) - 3675959..3676351 (-) 393 WP_008576847.1 H-NS family nucleoid-associated regulatory protein -
  R5577_RS15660 (R5577_15660) - 3676442..3676834 (-) 393 WP_057681806.1 hypothetical protein -
  R5577_RS15665 (R5577_15665) - 3676945..3677637 (-) 693 WP_109291630.1 thermonuclease family protein -
  R5577_RS15670 (R5577_15670) - 3677830..3677982 (-) 153 WP_181388292.1 hypothetical protein -
  R5577_RS15675 (R5577_15675) - 3678611..3678979 (+) 369 WP_317720311.1 hypothetical protein -
  R5577_RS15680 (R5577_15680) - 3679023..3680612 (-) 1590 WP_218533055.1 MobA/MobL family protein -
  R5577_RS15685 (R5577_15685) - 3680871..3681197 (+) 327 WP_109292192.1 hypothetical protein -
  R5577_RS15690 (R5577_15690) - 3681378..3681698 (+) 321 WP_078583506.1 HNH endonuclease -
  R5577_RS15695 (R5577_15695) - 3681926..3682384 (+) 459 WP_078583507.1 very short patch repair endonuclease -
  R5577_RS15700 (R5577_15700) - 3682700..3683296 (+) 597 WP_317720312.1 ATP-binding protein -
  R5577_RS15705 (R5577_15705) - 3683892..3684200 (+) 309 WP_274503446.1 hypothetical protein -
  R5577_RS15710 (R5577_15710) - 3684213..3686927 (+) 2715 WP_078583509.1 Z1 domain-containing protein -
  R5577_RS15715 (R5577_15715) - 3686890..3687885 (+) 996 WP_078583510.1 PD-(D/E)XK motif protein -
  R5577_RS15720 (R5577_15720) - 3687885..3689945 (+) 2061 WP_317720314.1 AIPR family protein -
  R5577_RS15725 (R5577_15725) - 3690092..3690400 (-) 309 WP_317720315.1 DNA cytosine methyltransferase -
  R5577_RS15730 (R5577_15730) - 3690397..3691629 (-) 1233 WP_317720317.1 DNA cytosine methyltransferase -
  R5577_RS15735 (R5577_15735) - 3691955..3692356 (-) 402 Protein_3084 XVIPCD domain-containing protein -
  R5577_RS15740 (R5577_15740) - 3692359..3693387 (+) 1029 WP_317720318.1 hypothetical protein -
  R5577_RS15745 (R5577_15745) - 3693356..3693772 (-) 417 WP_146200122.1 hypothetical protein -
  R5577_RS15750 (R5577_15750) - 3694143..3694334 (-) 192 WP_109292205.1 hypothetical protein -
  R5577_RS15755 (R5577_15755) radC 3694411..3694890 (-) 480 WP_109292207.1 DNA repair protein RadC -
  R5577_RS15760 (R5577_15760) - 3695167..3695706 (+) 540 WP_235658084.1 GNAT family N-acetyltransferase -
  R5577_RS15765 (R5577_15765) - 3695804..3696931 (+) 1128 WP_317720319.1 hypothetical protein -
  R5577_RS15770 (R5577_15770) - 3697009..3698111 (+) 1103 WP_094030629.1 IS3 family transposase -
  R5577_RS15775 (R5577_15775) - 3698361..3699041 (-) 681 WP_202903012.1 SprT family zinc-dependent metalloprotease -
  R5577_RS15780 (R5577_15780) - 3699079..3702420 (-) 3342 WP_317720321.1 type I restriction endonuclease subunit R -
  R5577_RS15785 (R5577_15785) - 3702595..3704256 (-) 1662 WP_031421491.1 ATP-binding protein -
  R5577_RS15790 (R5577_15790) - 3704253..3705569 (-) 1317 WP_109292118.1 restriction endonuclease subunit S -
  R5577_RS15795 (R5577_15795) - 3705562..3708063 (-) 2502 WP_109292120.1 class I SAM-dependent DNA methyltransferase -
  R5577_RS15800 (R5577_15800) - 3708208..3709097 (-) 890 Protein_3097 restriction endonuclease -
  R5577_RS15805 (R5577_15805) - 3709138..3709446 (-) 309 WP_011346670.1 type II toxin-antitoxin system RelE/ParE family toxin -
  R5577_RS15810 (R5577_15810) - 3709453..3709716 (-) 264 WP_031421482.1 YlcI/YnfO family protein -
  R5577_RS15815 (R5577_15815) - 3709861..3710007 (-) 147 Protein_3100 MarR family transcriptional regulator -
  R5577_RS15820 (R5577_15820) - 3710135..3710668 (-) 534 WP_317720322.1 XVIPCD domain-containing protein -
  R5577_RS15825 (R5577_15825) - 3710734..3711354 (-) 621 WP_228729048.1 hypothetical protein -

Sequence


Protein


Download         Length: 39 a.a.        Molecular weight: 4228.90 Da        Isoelectric Point: 11.0200

>NTDB_id=898950 R5577_RS15580 WP_230440136.1 3657635..3657754(-) (pilB) [Xanthomonas euvesicatoria strain T0319-01]
MQIAEAAQKIGIRDLRQSASMKAARGVTSLAEINRVTKD

Nucleotide


Download         Length: 120 bp        

>NTDB_id=898950 R5577_RS15580 WP_230440136.1 3657635..3657754(-) (pilB) [Xanthomonas euvesicatoria strain T0319-01]
ATGCAGATCGCCGAGGCGGCGCAGAAGATCGGTATTCGCGATTTGCGCCAGTCGGCGTCGATGAAGGCTGCGCGTGGGGT
GACCAGCCTGGCGGAAATCAATCGTGTGACGAAGGACTAA

Domains



No domain identified.



Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  pilB Acinetobacter baumannii D1279779

48.718

100

0.487

  pilB Acinetobacter baylyi ADP1

48.718

100

0.487

  pilB Legionella pneumophila strain ERS1305867

38.462

100

0.385

  pilF Neisseria gonorrhoeae MS11

40.541

94.872

0.385