Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | R5577_RS15580 | Genome accession | NZ_CP137539 |
| Coordinates | 3657635..3657754 (-) | Length | 39 a.a. |
| NCBI ID | WP_230440136.1 | Uniprot ID | - |
| Organism | Xanthomonas euvesicatoria strain T0319-01 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| ICE | 3642692..3712405 | 3657635..3657754 | within | 0 |
Gene organization within MGE regions
Location: 3642692..3712405
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| R5577_RS15505 (R5577_15505) | - | 3643766..3644200 (-) | 435 | WP_031423856.1 | thiol-disulfide oxidoreductase DCC family protein | - |
| R5577_RS15510 (R5577_15510) | - | 3644187..3644711 (-) | 525 | WP_031423858.1 | DUF4166 domain-containing protein | - |
| R5577_RS15515 (R5577_15515) | pgeF | 3644714..3645526 (-) | 813 | WP_109290735.1 | peptidoglycan editing factor PgeF | - |
| R5577_RS15520 (R5577_15520) | rluD | 3645528..3646523 (-) | 996 | WP_008577792.1 | 23S rRNA pseudouridine(1911/1915/1917) synthase RluD | - |
| R5577_RS15525 (R5577_15525) | - | 3646645..3647527 (+) | 883 | Protein_3042 | outer membrane protein assembly factor BamD | - |
| R5577_RS15530 (R5577_15530) | - | 3647809..3648786 (+) | 978 | WP_219930962.1 | hypothetical protein | - |
| R5577_RS15535 (R5577_15535) | - | 3648805..3650460 (-) | 1656 | WP_317720309.1 | NAD+ synthase | - |
| R5577_RS15540 (R5577_15540) | - | 3650460..3650762 (-) | 303 | WP_008577789.1 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| R5577_RS15545 (R5577_15545) | - | 3650766..3651110 (-) | 345 | WP_008577787.1 | ribbon-helix-helix domain-containing protein | - |
| R5577_RS15550 (R5577_15550) | sucD | 3651281..3652156 (-) | 876 | WP_029820064.1 | succinate--CoA ligase subunit alpha | - |
| R5577_RS15555 (R5577_15555) | sucC | 3652181..3653350 (-) | 1170 | WP_317718950.1 | ADP-forming succinate--CoA ligase subunit beta | - |
| R5577_RS15560 (R5577_15560) | - | 3653581..3655194 (+) | 1614 | WP_317718951.1 | HAMP domain-containing sensor histidine kinase | - |
| R5577_RS15565 (R5577_15565) | pilR | 3655461..3656915 (+) | 1455 | WP_317718952.1 | sigma-54 dependent transcriptional regulator | Regulator |
| R5577_RS15570 (R5577_15570) | - | 3657136..3657255 (-) | 120 | WP_317718953.1 | pilus assembly protein | - |
| R5577_RS15575 (R5577_15575) | pilB | 3657384..3657503 (-) | 120 | WP_029220459.1 | hypothetical protein | Machinery gene |
| R5577_RS15580 (R5577_15580) | pilB | 3657635..3657754 (-) | 120 | WP_230440136.1 | pilus assembly protein | Machinery gene |
| R5577_RS15585 (R5577_15585) | pilB | 3657884..3659620 (-) | 1737 | WP_317718954.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| R5577_RS15590 (R5577_15590) | - | 3659662..3660081 (-) | 420 | WP_317718955.1 | pilin | - |
| R5577_RS15595 (R5577_15595) | - | 3660135..3660554 (-) | 420 | WP_317718956.1 | pilin | - |
| R5577_RS15600 (R5577_15600) | pilC | 3660931..3662190 (+) | 1260 | WP_317718957.1 | type II secretion system F family protein | Machinery gene |
| R5577_RS15605 (R5577_15605) | - | 3662197..3663060 (+) | 864 | WP_003491180.1 | A24 family peptidase | - |
| R5577_RS15610 (R5577_15610) | coaE | 3663074..3663685 (+) | 612 | WP_109290722.1 | dephospho-CoA kinase | - |
| R5577_RS15615 (R5577_15615) | - | 3664362..3667259 (+) | 2898 | Protein_3060 | DUF6531 domain-containing protein | - |
| R5577_RS15620 (R5577_15620) | - | 3667326..3668428 (+) | 1103 | WP_094030629.1 | IS3 family transposase | - |
| R5577_RS15625 (R5577_15625) | - | 3668747..3669029 (+) | 283 | Protein_3062 | SymE family type I addiction module toxin | - |
| R5577_RS15630 (R5577_15630) | - | 3669132..3670466 (-) | 1335 | WP_011348346.1 | HAMP domain-containing sensor histidine kinase | - |
| R5577_RS15635 (R5577_15635) | - | 3670459..3671136 (-) | 678 | WP_003490678.1 | response regulator transcription factor | - |
| R5577_RS15640 (R5577_15640) | - | 3671162..3671605 (-) | 444 | WP_008576857.1 | hypothetical protein | - |
| R5577_RS15645 (R5577_15645) | rimK | 3671814..3672731 (-) | 918 | WP_008576854.1 | 30S ribosomal protein S6--L-glutamate ligase | - |
| R5577_RS15650 (R5577_15650) | glgX | 3673202..3675334 (+) | 2133 | WP_109291632.1 | glycogen debranching protein GlgX | - |
| R5577_RS15655 (R5577_15655) | - | 3675959..3676351 (-) | 393 | WP_008576847.1 | H-NS family nucleoid-associated regulatory protein | - |
| R5577_RS15660 (R5577_15660) | - | 3676442..3676834 (-) | 393 | WP_057681806.1 | hypothetical protein | - |
| R5577_RS15665 (R5577_15665) | - | 3676945..3677637 (-) | 693 | WP_109291630.1 | thermonuclease family protein | - |
| R5577_RS15670 (R5577_15670) | - | 3677830..3677982 (-) | 153 | WP_181388292.1 | hypothetical protein | - |
| R5577_RS15675 (R5577_15675) | - | 3678611..3678979 (+) | 369 | WP_317720311.1 | hypothetical protein | - |
| R5577_RS15680 (R5577_15680) | - | 3679023..3680612 (-) | 1590 | WP_218533055.1 | MobA/MobL family protein | - |
| R5577_RS15685 (R5577_15685) | - | 3680871..3681197 (+) | 327 | WP_109292192.1 | hypothetical protein | - |
| R5577_RS15690 (R5577_15690) | - | 3681378..3681698 (+) | 321 | WP_078583506.1 | HNH endonuclease | - |
| R5577_RS15695 (R5577_15695) | - | 3681926..3682384 (+) | 459 | WP_078583507.1 | very short patch repair endonuclease | - |
| R5577_RS15700 (R5577_15700) | - | 3682700..3683296 (+) | 597 | WP_317720312.1 | ATP-binding protein | - |
| R5577_RS15705 (R5577_15705) | - | 3683892..3684200 (+) | 309 | WP_274503446.1 | hypothetical protein | - |
| R5577_RS15710 (R5577_15710) | - | 3684213..3686927 (+) | 2715 | WP_078583509.1 | Z1 domain-containing protein | - |
| R5577_RS15715 (R5577_15715) | - | 3686890..3687885 (+) | 996 | WP_078583510.1 | PD-(D/E)XK motif protein | - |
| R5577_RS15720 (R5577_15720) | - | 3687885..3689945 (+) | 2061 | WP_317720314.1 | AIPR family protein | - |
| R5577_RS15725 (R5577_15725) | - | 3690092..3690400 (-) | 309 | WP_317720315.1 | DNA cytosine methyltransferase | - |
| R5577_RS15730 (R5577_15730) | - | 3690397..3691629 (-) | 1233 | WP_317720317.1 | DNA cytosine methyltransferase | - |
| R5577_RS15735 (R5577_15735) | - | 3691955..3692356 (-) | 402 | Protein_3084 | XVIPCD domain-containing protein | - |
| R5577_RS15740 (R5577_15740) | - | 3692359..3693387 (+) | 1029 | WP_317720318.1 | hypothetical protein | - |
| R5577_RS15745 (R5577_15745) | - | 3693356..3693772 (-) | 417 | WP_146200122.1 | hypothetical protein | - |
| R5577_RS15750 (R5577_15750) | - | 3694143..3694334 (-) | 192 | WP_109292205.1 | hypothetical protein | - |
| R5577_RS15755 (R5577_15755) | radC | 3694411..3694890 (-) | 480 | WP_109292207.1 | DNA repair protein RadC | - |
| R5577_RS15760 (R5577_15760) | - | 3695167..3695706 (+) | 540 | WP_235658084.1 | GNAT family N-acetyltransferase | - |
| R5577_RS15765 (R5577_15765) | - | 3695804..3696931 (+) | 1128 | WP_317720319.1 | hypothetical protein | - |
| R5577_RS15770 (R5577_15770) | - | 3697009..3698111 (+) | 1103 | WP_094030629.1 | IS3 family transposase | - |
| R5577_RS15775 (R5577_15775) | - | 3698361..3699041 (-) | 681 | WP_202903012.1 | SprT family zinc-dependent metalloprotease | - |
| R5577_RS15780 (R5577_15780) | - | 3699079..3702420 (-) | 3342 | WP_317720321.1 | type I restriction endonuclease subunit R | - |
| R5577_RS15785 (R5577_15785) | - | 3702595..3704256 (-) | 1662 | WP_031421491.1 | ATP-binding protein | - |
| R5577_RS15790 (R5577_15790) | - | 3704253..3705569 (-) | 1317 | WP_109292118.1 | restriction endonuclease subunit S | - |
| R5577_RS15795 (R5577_15795) | - | 3705562..3708063 (-) | 2502 | WP_109292120.1 | class I SAM-dependent DNA methyltransferase | - |
| R5577_RS15800 (R5577_15800) | - | 3708208..3709097 (-) | 890 | Protein_3097 | restriction endonuclease | - |
| R5577_RS15805 (R5577_15805) | - | 3709138..3709446 (-) | 309 | WP_011346670.1 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| R5577_RS15810 (R5577_15810) | - | 3709453..3709716 (-) | 264 | WP_031421482.1 | YlcI/YnfO family protein | - |
| R5577_RS15815 (R5577_15815) | - | 3709861..3710007 (-) | 147 | Protein_3100 | MarR family transcriptional regulator | - |
| R5577_RS15820 (R5577_15820) | - | 3710135..3710668 (-) | 534 | WP_317720322.1 | XVIPCD domain-containing protein | - |
| R5577_RS15825 (R5577_15825) | - | 3710734..3711354 (-) | 621 | WP_228729048.1 | hypothetical protein | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4228.90 Da Isoelectric Point: 11.0200
>NTDB_id=898950 R5577_RS15580 WP_230440136.1 3657635..3657754(-) (pilB) [Xanthomonas euvesicatoria strain T0319-01]
MQIAEAAQKIGIRDLRQSASMKAARGVTSLAEINRVTKD
MQIAEAAQKIGIRDLRQSASMKAARGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=898950 R5577_RS15580 WP_230440136.1 3657635..3657754(-) (pilB) [Xanthomonas euvesicatoria strain T0319-01]
ATGCAGATCGCCGAGGCGGCGCAGAAGATCGGTATTCGCGATTTGCGCCAGTCGGCGTCGATGAAGGCTGCGCGTGGGGT
GACCAGCCTGGCGGAAATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCGGCGCAGAAGATCGGTATTCGCGATTTGCGCCAGTCGGCGTCGATGAAGGCTGCGCGTGGGGT
GACCAGCCTGGCGGAAATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Acinetobacter baylyi ADP1 |
48.718 |
100 |
0.487 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |
| pilF | Neisseria gonorrhoeae MS11 |
40.541 |
94.872 |
0.385 |