Detailed information    

insolico Bioinformatically predicted

Overview


Name   pilB   Type   Machinery gene
Locus tag   R2B60_RS15515 Genome accession   NZ_CP137532
Coordinates   3669759..3669878 (-) Length   39 a.a.
NCBI ID   WP_029220459.1    Uniprot ID   A0A7Z2ZHL3
Organism   Xanthomonas euvesicatoria strain XpT39     
Function   power the assembly of type IV pilus (predicted from homology)   
DNA binding and uptake

Related MGE


Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type MGE coordinates Gene coordinates Relative position Distance (bp)
ICE 3655068..3724787 3669759..3669878 within 0


Gene organization within MGE regions


Location: 3655068..3724787
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  R2B60_RS15445 (R2B60_15445) - 3656142..3656576 (-) 435 WP_031423856.1 thiol-disulfide oxidoreductase DCC family protein -
  R2B60_RS15450 (R2B60_15450) - 3656563..3657087 (-) 525 WP_031423858.1 DUF4166 domain-containing protein -
  R2B60_RS15455 (R2B60_15455) pgeF 3657090..3657902 (-) 813 WP_109290735.1 peptidoglycan editing factor PgeF -
  R2B60_RS15460 (R2B60_15460) rluD 3657904..3658899 (-) 996 WP_008577792.1 23S rRNA pseudouridine(1911/1915/1917) synthase RluD -
  R2B60_RS15465 (R2B60_15465) - 3659021..3659902 (+) 882 WP_005915798.1 outer membrane protein assembly factor BamD -
  R2B60_RS15470 (R2B60_15470) - 3660184..3661161 (+) 978 WP_219930962.1 hypothetical protein -
  R2B60_RS15475 (R2B60_15475) - 3661180..3662835 (-) 1656 WP_031423861.1 NAD+ synthase -
  R2B60_RS15480 (R2B60_15480) - 3662835..3663137 (-) 303 WP_008577789.1 type II toxin-antitoxin system RelE/ParE family toxin -
  R2B60_RS15485 (R2B60_15485) - 3663141..3663485 (-) 345 WP_008577787.1 ribbon-helix-helix domain-containing protein -
  R2B60_RS15490 (R2B60_15490) sucD 3663656..3664531 (-) 876 WP_029820064.1 succinate--CoA ligase subunit alpha -
  R2B60_RS15495 (R2B60_15495) sucC 3664556..3665725 (-) 1170 WP_317718950.1 ADP-forming succinate--CoA ligase subunit beta -
  R2B60_RS15500 (R2B60_15500) - 3665956..3667569 (+) 1614 WP_317718951.1 HAMP domain-containing sensor histidine kinase -
  R2B60_RS15505 (R2B60_15505) pilR 3667836..3669290 (+) 1455 WP_317718952.1 sigma-54 dependent transcriptional regulator Regulator
  R2B60_RS15510 (R2B60_15510) - 3669511..3669630 (-) 120 WP_317718953.1 pilus assembly protein -
  R2B60_RS15515 (R2B60_15515) pilB 3669759..3669878 (-) 120 WP_029220459.1 hypothetical protein Machinery gene
  R2B60_RS15520 (R2B60_15520) pilB 3670010..3670129 (-) 120 WP_230440136.1 pilus assembly protein Machinery gene
  R2B60_RS15525 (R2B60_15525) pilB 3670259..3671995 (-) 1737 WP_317718954.1 type IV-A pilus assembly ATPase PilB Machinery gene
  R2B60_RS15530 (R2B60_15530) - 3672037..3672456 (-) 420 WP_317718955.1 pilin -
  R2B60_RS15535 (R2B60_15535) - 3672510..3672929 (-) 420 WP_317718956.1 pilin -
  R2B60_RS15540 (R2B60_15540) pilC 3673306..3674565 (+) 1260 WP_317718957.1 type II secretion system F family protein Machinery gene
  R2B60_RS15545 (R2B60_15545) - 3674572..3675435 (+) 864 WP_003491180.1 A24 family peptidase -
  R2B60_RS15550 (R2B60_15550) coaE 3675449..3676060 (+) 612 WP_109290722.1 dephospho-CoA kinase -
  R2B60_RS15555 (R2B60_15555) - 3676737..3679673 (+) 2937 Protein_3047 DUF6531 domain-containing protein -
  R2B60_RS15560 (R2B60_15560) - 3679702..3680804 (+) 1103 WP_094030629.1 IS3 family transposase -
  R2B60_RS15565 (R2B60_15565) - 3681123..3681405 (+) 283 Protein_3049 SymE family type I addiction module toxin -
  R2B60_RS15570 (R2B60_15570) - 3681508..3682842 (-) 1335 WP_011348346.1 HAMP domain-containing sensor histidine kinase -
  R2B60_RS15575 (R2B60_15575) - 3682835..3683512 (-) 678 WP_003490678.1 response regulator transcription factor -
  R2B60_RS15580 (R2B60_15580) - 3683538..3683981 (-) 444 WP_008576857.1 hypothetical protein -
  R2B60_RS15585 (R2B60_15585) rimK 3684190..3685107 (-) 918 WP_008576854.1 30S ribosomal protein S6--L-glutamate ligase -
  R2B60_RS15590 (R2B60_15590) glgX 3685578..3687710 (+) 2133 WP_109291632.1 glycogen debranching protein GlgX -
  R2B60_RS15595 (R2B60_15595) - 3688335..3688727 (-) 393 WP_008576847.1 H-NS family nucleoid-associated regulatory protein -
  R2B60_RS15600 (R2B60_15600) - 3688818..3689210 (-) 393 WP_057681806.1 hypothetical protein -
  R2B60_RS15605 (R2B60_15605) - 3689321..3690013 (-) 693 WP_109291630.1 thermonuclease family protein -
  R2B60_RS15610 (R2B60_15610) - 3690987..3691355 (+) 369 WP_015471731.1 hypothetical protein -
  R2B60_RS15615 (R2B60_15615) - 3691399..3692988 (-) 1590 WP_218533055.1 MobA/MobL family protein -
  R2B60_RS15620 (R2B60_15620) - 3693247..3693573 (+) 327 WP_109292192.1 hypothetical protein -
  R2B60_RS15625 (R2B60_15625) - 3693754..3694074 (+) 321 WP_078583506.1 HNH endonuclease -
  R2B60_RS15630 (R2B60_15630) - 3694302..3694760 (+) 459 WP_078583507.1 very short patch repair endonuclease -
  R2B60_RS15635 (R2B60_15635) - 3695076..3696578 (+) 1503 WP_109292194.1 ATP-binding protein -
  R2B60_RS15640 (R2B60_15640) - 3696591..3699305 (+) 2715 WP_078583509.1 Z1 domain-containing protein -
  R2B60_RS15645 (R2B60_15645) - 3699268..3700263 (+) 996 WP_078583510.1 PD-(D/E)XK motif protein -
  R2B60_RS15650 (R2B60_15650) - 3700263..3702323 (+) 2061 WP_109292196.1 AIPR family protein -
  R2B60_RS15655 (R2B60_15655) - 3702470..3704008 (-) 1539 WP_235658083.1 DNA cytosine methyltransferase -
  R2B60_RS15660 (R2B60_15660) - 3704334..3705743 (-) 1410 WP_109292201.1 XVIPCD domain-containing protein -
  R2B60_RS15665 (R2B60_15665) - 3705736..3706152 (-) 417 WP_146200122.1 hypothetical protein -
  R2B60_RS15670 (R2B60_15670) - 3706523..3706714 (-) 192 WP_109292205.1 hypothetical protein -
  R2B60_RS15675 (R2B60_15675) radC 3706791..3707270 (-) 480 WP_109292207.1 DNA repair protein RadC -
  R2B60_RS15680 (R2B60_15680) - 3707547..3708086 (+) 540 WP_235658084.1 GNAT family N-acetyltransferase -
  R2B60_RS15685 (R2B60_15685) - 3708184..3709311 (+) 1128 WP_146200123.1 hypothetical protein -
  R2B60_RS15690 (R2B60_15690) - 3709390..3710492 (+) 1103 WP_094030629.1 IS3 family transposase -
  R2B60_RS15695 (R2B60_15695) - 3710742..3711443 (-) 702 WP_031421495.1 SprT family zinc-dependent metalloprotease -
  R2B60_RS15700 (R2B60_15700) - 3711460..3714801 (-) 3342 WP_109292147.1 type I restriction endonuclease subunit R -
  R2B60_RS15705 (R2B60_15705) - 3714976..3716637 (-) 1662 WP_031421491.1 ATP-binding protein -
  R2B60_RS15710 (R2B60_15710) - 3716634..3717950 (-) 1317 WP_109292118.1 restriction endonuclease subunit S -
  R2B60_RS15715 (R2B60_15715) - 3717943..3720444 (-) 2502 WP_109292120.1 class I SAM-dependent DNA methyltransferase -
  R2B60_RS15720 (R2B60_15720) - 3720589..3721479 (-) 891 WP_109292123.1 restriction endonuclease -
  R2B60_RS15725 (R2B60_15725) - 3721520..3721828 (-) 309 WP_011346670.1 type II toxin-antitoxin system RelE/ParE family toxin -
  R2B60_RS15730 (R2B60_15730) - 3721835..3722098 (-) 264 WP_031421482.1 YlcI/YnfO family protein -
  R2B60_RS15735 (R2B60_15735) - 3722243..3722389 (-) 147 Protein_3083 MarR family transcriptional regulator -
  R2B60_RS15740 (R2B60_15740) - 3722517..3722765 (-) 249 WP_317718958.1 XVIPCD domain-containing protein -
  R2B60_RS15745 (R2B60_15745) - 3722769..3723119 (+) 351 WP_317718959.1 hypothetical protein -
  R2B60_RS15750 (R2B60_15750) - 3723116..3724033 (-) 918 WP_228737804.1 hypothetical protein -

Sequence


Protein


Download         Length: 39 a.a.        Molecular weight: 4235.93 Da        Isoelectric Point: 10.4810

>NTDB_id=898932 R2B60_RS15515 WP_029220459.1 3669759..3669878(-) (pilB) [Xanthomonas euvesicatoria strain XpT39]
MQIAEAAQKIGIRDLRQSALMKAAHGVTSLAEINRVTKD

Nucleotide


Download         Length: 120 bp        

>NTDB_id=898932 R2B60_RS15515 WP_029220459.1 3669759..3669878(-) (pilB) [Xanthomonas euvesicatoria strain XpT39]
ATGCAGATTGCCGAGGCGGCGCAGAAGATCGGTATTCGCGATTTGCGCCAGTCGGCGTTGATGAAGGCTGCGCATGGGGT
GACCAGCCTGGCGGAAATCAATCGTGTGACGAAGGACTAA

Domains



No domain identified.



Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB A0A7Z2ZHL3

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  pilB Acinetobacter baumannii D1279779

51.282

100

0.513

  pilB Acinetobacter baylyi ADP1

51.282

100

0.513

  pilB Legionella pneumophila strain ERS1305867

38.462

100

0.385

  pilF Neisseria gonorrhoeae MS11

40.541

94.872

0.385

  pilB Vibrio cholerae strain A1552

42.857

89.744

0.385