Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | R2B60_RS15515 | Genome accession | NZ_CP137532 |
| Coordinates | 3669759..3669878 (-) | Length | 39 a.a. |
| NCBI ID | WP_029220459.1 | Uniprot ID | A0A7Z2ZHL3 |
| Organism | Xanthomonas euvesicatoria strain XpT39 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| ICE | 3655068..3724787 | 3669759..3669878 | within | 0 |
Gene organization within MGE regions
Location: 3655068..3724787
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| R2B60_RS15445 (R2B60_15445) | - | 3656142..3656576 (-) | 435 | WP_031423856.1 | thiol-disulfide oxidoreductase DCC family protein | - |
| R2B60_RS15450 (R2B60_15450) | - | 3656563..3657087 (-) | 525 | WP_031423858.1 | DUF4166 domain-containing protein | - |
| R2B60_RS15455 (R2B60_15455) | pgeF | 3657090..3657902 (-) | 813 | WP_109290735.1 | peptidoglycan editing factor PgeF | - |
| R2B60_RS15460 (R2B60_15460) | rluD | 3657904..3658899 (-) | 996 | WP_008577792.1 | 23S rRNA pseudouridine(1911/1915/1917) synthase RluD | - |
| R2B60_RS15465 (R2B60_15465) | - | 3659021..3659902 (+) | 882 | WP_005915798.1 | outer membrane protein assembly factor BamD | - |
| R2B60_RS15470 (R2B60_15470) | - | 3660184..3661161 (+) | 978 | WP_219930962.1 | hypothetical protein | - |
| R2B60_RS15475 (R2B60_15475) | - | 3661180..3662835 (-) | 1656 | WP_031423861.1 | NAD+ synthase | - |
| R2B60_RS15480 (R2B60_15480) | - | 3662835..3663137 (-) | 303 | WP_008577789.1 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| R2B60_RS15485 (R2B60_15485) | - | 3663141..3663485 (-) | 345 | WP_008577787.1 | ribbon-helix-helix domain-containing protein | - |
| R2B60_RS15490 (R2B60_15490) | sucD | 3663656..3664531 (-) | 876 | WP_029820064.1 | succinate--CoA ligase subunit alpha | - |
| R2B60_RS15495 (R2B60_15495) | sucC | 3664556..3665725 (-) | 1170 | WP_317718950.1 | ADP-forming succinate--CoA ligase subunit beta | - |
| R2B60_RS15500 (R2B60_15500) | - | 3665956..3667569 (+) | 1614 | WP_317718951.1 | HAMP domain-containing sensor histidine kinase | - |
| R2B60_RS15505 (R2B60_15505) | pilR | 3667836..3669290 (+) | 1455 | WP_317718952.1 | sigma-54 dependent transcriptional regulator | Regulator |
| R2B60_RS15510 (R2B60_15510) | - | 3669511..3669630 (-) | 120 | WP_317718953.1 | pilus assembly protein | - |
| R2B60_RS15515 (R2B60_15515) | pilB | 3669759..3669878 (-) | 120 | WP_029220459.1 | hypothetical protein | Machinery gene |
| R2B60_RS15520 (R2B60_15520) | pilB | 3670010..3670129 (-) | 120 | WP_230440136.1 | pilus assembly protein | Machinery gene |
| R2B60_RS15525 (R2B60_15525) | pilB | 3670259..3671995 (-) | 1737 | WP_317718954.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| R2B60_RS15530 (R2B60_15530) | - | 3672037..3672456 (-) | 420 | WP_317718955.1 | pilin | - |
| R2B60_RS15535 (R2B60_15535) | - | 3672510..3672929 (-) | 420 | WP_317718956.1 | pilin | - |
| R2B60_RS15540 (R2B60_15540) | pilC | 3673306..3674565 (+) | 1260 | WP_317718957.1 | type II secretion system F family protein | Machinery gene |
| R2B60_RS15545 (R2B60_15545) | - | 3674572..3675435 (+) | 864 | WP_003491180.1 | A24 family peptidase | - |
| R2B60_RS15550 (R2B60_15550) | coaE | 3675449..3676060 (+) | 612 | WP_109290722.1 | dephospho-CoA kinase | - |
| R2B60_RS15555 (R2B60_15555) | - | 3676737..3679673 (+) | 2937 | Protein_3047 | DUF6531 domain-containing protein | - |
| R2B60_RS15560 (R2B60_15560) | - | 3679702..3680804 (+) | 1103 | WP_094030629.1 | IS3 family transposase | - |
| R2B60_RS15565 (R2B60_15565) | - | 3681123..3681405 (+) | 283 | Protein_3049 | SymE family type I addiction module toxin | - |
| R2B60_RS15570 (R2B60_15570) | - | 3681508..3682842 (-) | 1335 | WP_011348346.1 | HAMP domain-containing sensor histidine kinase | - |
| R2B60_RS15575 (R2B60_15575) | - | 3682835..3683512 (-) | 678 | WP_003490678.1 | response regulator transcription factor | - |
| R2B60_RS15580 (R2B60_15580) | - | 3683538..3683981 (-) | 444 | WP_008576857.1 | hypothetical protein | - |
| R2B60_RS15585 (R2B60_15585) | rimK | 3684190..3685107 (-) | 918 | WP_008576854.1 | 30S ribosomal protein S6--L-glutamate ligase | - |
| R2B60_RS15590 (R2B60_15590) | glgX | 3685578..3687710 (+) | 2133 | WP_109291632.1 | glycogen debranching protein GlgX | - |
| R2B60_RS15595 (R2B60_15595) | - | 3688335..3688727 (-) | 393 | WP_008576847.1 | H-NS family nucleoid-associated regulatory protein | - |
| R2B60_RS15600 (R2B60_15600) | - | 3688818..3689210 (-) | 393 | WP_057681806.1 | hypothetical protein | - |
| R2B60_RS15605 (R2B60_15605) | - | 3689321..3690013 (-) | 693 | WP_109291630.1 | thermonuclease family protein | - |
| R2B60_RS15610 (R2B60_15610) | - | 3690987..3691355 (+) | 369 | WP_015471731.1 | hypothetical protein | - |
| R2B60_RS15615 (R2B60_15615) | - | 3691399..3692988 (-) | 1590 | WP_218533055.1 | MobA/MobL family protein | - |
| R2B60_RS15620 (R2B60_15620) | - | 3693247..3693573 (+) | 327 | WP_109292192.1 | hypothetical protein | - |
| R2B60_RS15625 (R2B60_15625) | - | 3693754..3694074 (+) | 321 | WP_078583506.1 | HNH endonuclease | - |
| R2B60_RS15630 (R2B60_15630) | - | 3694302..3694760 (+) | 459 | WP_078583507.1 | very short patch repair endonuclease | - |
| R2B60_RS15635 (R2B60_15635) | - | 3695076..3696578 (+) | 1503 | WP_109292194.1 | ATP-binding protein | - |
| R2B60_RS15640 (R2B60_15640) | - | 3696591..3699305 (+) | 2715 | WP_078583509.1 | Z1 domain-containing protein | - |
| R2B60_RS15645 (R2B60_15645) | - | 3699268..3700263 (+) | 996 | WP_078583510.1 | PD-(D/E)XK motif protein | - |
| R2B60_RS15650 (R2B60_15650) | - | 3700263..3702323 (+) | 2061 | WP_109292196.1 | AIPR family protein | - |
| R2B60_RS15655 (R2B60_15655) | - | 3702470..3704008 (-) | 1539 | WP_235658083.1 | DNA cytosine methyltransferase | - |
| R2B60_RS15660 (R2B60_15660) | - | 3704334..3705743 (-) | 1410 | WP_109292201.1 | XVIPCD domain-containing protein | - |
| R2B60_RS15665 (R2B60_15665) | - | 3705736..3706152 (-) | 417 | WP_146200122.1 | hypothetical protein | - |
| R2B60_RS15670 (R2B60_15670) | - | 3706523..3706714 (-) | 192 | WP_109292205.1 | hypothetical protein | - |
| R2B60_RS15675 (R2B60_15675) | radC | 3706791..3707270 (-) | 480 | WP_109292207.1 | DNA repair protein RadC | - |
| R2B60_RS15680 (R2B60_15680) | - | 3707547..3708086 (+) | 540 | WP_235658084.1 | GNAT family N-acetyltransferase | - |
| R2B60_RS15685 (R2B60_15685) | - | 3708184..3709311 (+) | 1128 | WP_146200123.1 | hypothetical protein | - |
| R2B60_RS15690 (R2B60_15690) | - | 3709390..3710492 (+) | 1103 | WP_094030629.1 | IS3 family transposase | - |
| R2B60_RS15695 (R2B60_15695) | - | 3710742..3711443 (-) | 702 | WP_031421495.1 | SprT family zinc-dependent metalloprotease | - |
| R2B60_RS15700 (R2B60_15700) | - | 3711460..3714801 (-) | 3342 | WP_109292147.1 | type I restriction endonuclease subunit R | - |
| R2B60_RS15705 (R2B60_15705) | - | 3714976..3716637 (-) | 1662 | WP_031421491.1 | ATP-binding protein | - |
| R2B60_RS15710 (R2B60_15710) | - | 3716634..3717950 (-) | 1317 | WP_109292118.1 | restriction endonuclease subunit S | - |
| R2B60_RS15715 (R2B60_15715) | - | 3717943..3720444 (-) | 2502 | WP_109292120.1 | class I SAM-dependent DNA methyltransferase | - |
| R2B60_RS15720 (R2B60_15720) | - | 3720589..3721479 (-) | 891 | WP_109292123.1 | restriction endonuclease | - |
| R2B60_RS15725 (R2B60_15725) | - | 3721520..3721828 (-) | 309 | WP_011346670.1 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| R2B60_RS15730 (R2B60_15730) | - | 3721835..3722098 (-) | 264 | WP_031421482.1 | YlcI/YnfO family protein | - |
| R2B60_RS15735 (R2B60_15735) | - | 3722243..3722389 (-) | 147 | Protein_3083 | MarR family transcriptional regulator | - |
| R2B60_RS15740 (R2B60_15740) | - | 3722517..3722765 (-) | 249 | WP_317718958.1 | XVIPCD domain-containing protein | - |
| R2B60_RS15745 (R2B60_15745) | - | 3722769..3723119 (+) | 351 | WP_317718959.1 | hypothetical protein | - |
| R2B60_RS15750 (R2B60_15750) | - | 3723116..3724033 (-) | 918 | WP_228737804.1 | hypothetical protein | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4235.93 Da Isoelectric Point: 10.4810
>NTDB_id=898932 R2B60_RS15515 WP_029220459.1 3669759..3669878(-) (pilB) [Xanthomonas euvesicatoria strain XpT39]
MQIAEAAQKIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQKIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=898932 R2B60_RS15515 WP_029220459.1 3669759..3669878(-) (pilB) [Xanthomonas euvesicatoria strain XpT39]
ATGCAGATTGCCGAGGCGGCGCAGAAGATCGGTATTCGCGATTTGCGCCAGTCGGCGTTGATGAAGGCTGCGCATGGGGT
GACCAGCCTGGCGGAAATCAATCGTGTGACGAAGGACTAA
ATGCAGATTGCCGAGGCGGCGCAGAAGATCGGTATTCGCGATTTGCGCCAGTCGGCGTTGATGAAGGCTGCGCATGGGGT
GACCAGCCTGGCGGAAATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baumannii D1279779 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |
| pilF | Neisseria gonorrhoeae MS11 |
40.541 |
94.872 |
0.385 |
| pilB | Vibrio cholerae strain A1552 |
42.857 |
89.744 |
0.385 |