Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   RF668_RS04175 Genome accession   NZ_CP133787
Coordinates   826611..826907 (+) Length   98 a.a.
NCBI ID   WP_043736169.1    Uniprot ID   A0AAX4A863
Organism   Lactococcus cremoris strain KCKM 0438     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 821611..831907
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  RF668_RS04155 (RF668_04155) comGA 823949..824929 (+) 981 WP_043736167.1 competence type IV pilus ATPase ComGA Machinery gene
  RF668_RS04160 (RF668_04160) comGB 824829..825854 (+) 1026 WP_052206589.1 competence type IV pilus assembly protein ComGB Machinery gene
  RF668_RS04165 (RF668_04165) comGC 825898..826197 (+) 300 WP_052206590.1 competence type IV pilus major pilin ComGC Machinery gene
  RF668_RS04170 (RF668_04170) comGD 826208..826639 (+) 432 WP_050750513.1 competence type IV pilus minor pilin ComGD Machinery gene
  RF668_RS04175 (RF668_04175) comGE 826611..826907 (+) 297 WP_043736169.1 competence type IV pilus minor pilin ComGE Machinery gene
  RF668_RS04180 (RF668_04180) comGF 826891..827316 (+) 426 WP_374049086.1 competence type IV pilus minor pilin ComGF Machinery gene
  RF668_RS04185 (RF668_04185) comGG 827340..827639 (+) 300 WP_021037947.1 competence type IV pilus minor pilin ComGG Machinery gene
  RF668_RS04190 (RF668_04190) - 827720..828157 (+) 438 WP_011677180.1 zinc-dependent MarR family transcriptional regulator -
  RF668_RS04195 (RF668_04195) - 828154..828996 (+) 843 WP_011677179.1 metal ABC transporter solute-binding protein, Zn/Mn family -
  RF668_RS04200 (RF668_04200) - 829175..829912 (+) 738 WP_011836039.1 metal ABC transporter ATP-binding protein -
  RF668_RS04205 (RF668_04205) - 829905..830714 (+) 810 WP_011677177.1 metal ABC transporter permease -
  RF668_RS04210 (RF668_04210) - 830736..831608 (-) 873 WP_043736178.1 RluA family pseudouridine synthase -

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 10902.58 Da        Isoelectric Point: 5.8109

>NTDB_id=876870 RF668_RS04175 WP_043736169.1 826611..826907(+) (comGE) [Lactococcus cremoris strain KCKM 0438]
MENIKRKSIKGYILLESLISMALLSFLVTFLLSALTNSRQQEAQENQQIESLNVAQMAIESQLTELSLNGSVIKIRQGST
ATIISDHGKEILRLEAQN

Nucleotide


Download         Length: 297 bp        

>NTDB_id=876870 RF668_RS04175 WP_043736169.1 826611..826907(+) (comGE) [Lactococcus cremoris strain KCKM 0438]
GTGGAAAATATAAAAAGAAAATCAATTAAGGGATATATACTTCTTGAGAGCCTAATTAGTATGGCATTATTGAGCTTTTT
GGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGCACAAGAAAATCAACAAATTGAGTCCTTAAATG
TAGCTCAGATGGCAATAGAAAGTCAGTTGACGGAACTATCGTTAAATGGTTCTGTTATAAAAATAAGACAAGGTTCGACT
GCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

97.959

100

0.98