NTDB

Overview

Name	comGE/cglE	Type	Machinery gene
Locus tag	Q7620_RS10065	Genome accession	NZ_CP131713
Coordinates	1939146..1939448 (-)	Length	100 a.a.
NCBI ID	WP_000413382.1	Uniprot ID	-
Organism	Streptococcus pneumoniae strain 2008C09-276
Function	dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1934146..1944448

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
Q7620_RS10030 (Q7620_10000)	rnpA	1934828..1935199 (-)	372	WP_000739246.1	ribonuclease P protein component	-
Q7620_RS10035 (Q7620_10005)	-	1935216..1935347 (-)	132	WP_000768904.1	hypothetical protein	-
Q7620_RS10040 (Q7620_10010)	-	1935348..1936538 (-)	1191	WP_000167765.1	acetate kinase	-
Q7620_RS10045 (Q7620_10015)	comYH	1936589..1937542 (-)	954	WP_000345126.1	class I SAM-dependent methyltransferase	Machinery gene
Q7620_RS10050 (Q7620_10020)	-	1937603..1938195 (-)	593	Protein_1954	methyltransferase domain-containing protein	-
Q7620_RS10055 (Q7620_10025)	comGG/cglG	1938298..1938744 (-)	447	WP_001809944.1	competence type IV pilus minor pilin ComGG	Machinery gene
Q7620_RS10060 (Q7620_10030)	comGF/cglF	1938722..1939183 (-)	462	WP_000250531.1	competence type IV pilus minor pilin ComGF	Machinery gene
Q7620_RS10065 (Q7620_10035)	comGE/cglE	1939146..1939448 (-)	303	WP_000413382.1	competence type IV pilus minor pilin ComGE	Machinery gene
Q7620_RS10070 (Q7620_10040)	comGD/cglD	1939411..1939845 (-)	435	WP_033606693.1	competence type IV pilus minor pilin ComGD	Machinery gene
Q7620_RS10075 (Q7620_10045)	comGC/cglC	1939808..1940131 (-)	324	WP_000738628.1	comG operon protein ComGC	Machinery gene
Q7620_RS10080 (Q7620_10050)	comGB/cglB	1940133..1941149 (-)	1017	WP_078130737.1	competence type IV pilus assembly protein ComGB	Machinery gene
Q7620_RS10085 (Q7620_10055)	comGA/cglA/cilD	1941097..1942038 (-)	942	WP_000249536.1	competence type IV pilus ATPase ComGA	Machinery gene
Q7620_RS10090 (Q7620_10060)	-	1942114..1942479 (-)	366	WP_054407367.1	DUF1033 family protein	-
Q7620_RS10095 (Q7620_10065)	-	1942630..1943688 (-)	1059	WP_000649468.1	zinc-dependent alcohol dehydrogenase family protein	-

Sequence

Protein

Download Length: 100 a.a. Molecular weight: 11108.08 Da Isoelectric Point: 9.7273

                                >NTDB_id=864379 Q7620_RS10065 WP_000413382.1 1939146..1939448(-) (comGE/cglE) [Streptococcus pneumoniae strain 2008C09-276]

MEKLNALRKQKIRAVILLEAVVALAIFASIATLLLGQIQKNRQEEAKILQKEEVLRVAKMALQTGQNQVSINGVEIQVFS

SEKGLEVYHGSEQLLAIKEP

Nucleotide

Download Length: 303 bp

                                >NTDB_id=864379 Q7620_RS10065 WP_000413382.1 1939146..1939448(-) (comGE/cglE) [Streptococcus pneumoniae strain 2008C09-276]

ATGGAAAAATTAAACGCATTAAGGAAACAAAAAATTAGGGCAGTGATTTTACTGGAAGCAGTAGTCGCTCTAGCTATCTT

TGCCAGCATTGCGACCCTCCTTTTGGGACAAATTCAAAAAAATAGGCAAGAGGAAGCAAAAATCTTGCAAAAGGAAGAAG

TCTTGAGGGTAGCTAAGATGGCCTTGCAGACGGGGCAAAATCAGGTAAGCATCAACGGAGTTGAGATTCAGGTATTTTCT

AGTGAAAAAGGATTGGAGGTCTACCATGGTTCAGAACAGTTGTTGGCAATCAAAGAGCCATAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(16-97)

Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.

3D structure

Source	ID	Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.

Visualization of predicted probability:

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	H_a-value
comGE/cglE	Streptococcus pneumoniae Rx1	100	100	1
comGE/cglE	Streptococcus pneumoniae D39	100	100	1
comGE/cglE	Streptococcus pneumoniae R6	100	100	1
comGE/cglE	Streptococcus pneumoniae TIGR4	100	100	1
comGE/cglE	Streptococcus mitis NCTC 12261	98	100	0.98
comGE/cglE	Streptococcus mitis SK321	98	100	0.98
comYE	Streptococcus mutans UA140	44.444	90	0.4
comYE	Streptococcus mutans UA159	44.444	90	0.4

Detailed information NTG0864379