NTDB

Overview

Name	comGE/cglE	Type	Machinery gene
Locus tag	Q7626_RS09775	Genome accession	NZ_CP131707
Coordinates	1910207..1910509 (-)	Length	100 a.a.
NCBI ID	WP_000413382.1	Uniprot ID	-
Organism	Streptococcus pneumoniae strain 2018C08-270
Function	dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1905207..1915509

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
Q7626_RS09740 (Q7626_09725)	rnpA	1905886..1906257 (-)	372	WP_000739246.1	ribonuclease P protein component	-
Q7626_RS09745 (Q7626_09730)	-	1906274..1906405 (-)	132	WP_000768904.1	hypothetical protein	-
Q7626_RS09750 (Q7626_09735)	-	1906406..1907596 (-)	1191	WP_000167766.1	acetate kinase	-
Q7626_RS09755 (Q7626_09740)	comYH	1907647..1908600 (-)	954	WP_000345101.1	class I SAM-dependent methyltransferase	Machinery gene
Q7626_RS09760 (Q7626_09745)	-	1908661..1909255 (-)	595	Protein_1897	methyltransferase domain-containing protein	-
Q7626_RS09765 (Q7626_09750)	comGG/cglG	1909392..1909805 (-)	414	WP_000265624.1	competence type IV pilus minor pilin ComGG	Machinery gene
Q7626_RS09770 (Q7626_09755)	comGF/cglF	1909783..1910244 (-)	462	WP_000250542.1	competence type IV pilus minor pilin ComGF	Machinery gene
Q7626_RS09775 (Q7626_09760)	comGE/cglE	1910207..1910509 (-)	303	WP_000413382.1	competence type IV pilus minor pilin ComGE	Machinery gene
Q7626_RS09780 (Q7626_09765)	comGD/cglD	1910472..1910876 (-)	405	WP_000588013.1	competence type IV pilus minor pilin ComGD	Machinery gene
Q7626_RS09785 (Q7626_09770)	comGC/cglC	1910869..1911195 (-)	327	WP_000738636.1	comG operon protein ComGC	Machinery gene
Q7626_RS09790 (Q7626_09775)	comGB/cglB	1911197..1912213 (-)	1017	WP_012512625.1	competence type IV pilus assembly protein ComGB	Machinery gene
Q7626_RS09795 (Q7626_09780)	comGA/cglA/cilD	1912161..1913102 (-)	942	WP_000249552.1	competence type IV pilus ATPase ComGA	Machinery gene
Q7626_RS09800 (Q7626_09785)	-	1913178..1913543 (-)	366	WP_000286415.1	DUF1033 family protein	-
Q7626_RS09805 (Q7626_09790)	-	1913694..1914752 (-)	1059	WP_000649468.1	zinc-dependent alcohol dehydrogenase family protein	-

Sequence

Protein

Download Length: 100 a.a. Molecular weight: 11108.08 Da Isoelectric Point: 9.7273

                                >NTDB_id=863916 Q7626_RS09775 WP_000413382.1 1910207..1910509(-) (comGE/cglE) [Streptococcus pneumoniae strain 2018C08-270]

MEKLNALRKQKIRAVILLEAVVALAIFASIATLLLGQIQKNRQEEAKILQKEEVLRVAKMALQTGQNQVSINGVEIQVFS

SEKGLEVYHGSEQLLAIKEP

Nucleotide

Download Length: 303 bp

                                >NTDB_id=863916 Q7626_RS09775 WP_000413382.1 1910207..1910509(-) (comGE/cglE) [Streptococcus pneumoniae strain 2018C08-270]

ATGGAAAAATTAAACGCATTAAGGAAACAAAAAATTAGGGCAGTGATTTTACTGGAAGCAGTAGTCGCTCTAGCTATCTT

TGCCAGCATTGCGACCCTCCTTTTGGGACAAATTCAAAAAAATAGGCAAGAGGAAGCAAAAATCTTGCAAAAGGAAGAAG

TCTTGAGGGTAGCTAAGATGGCCCTGCAGACGGGGCAAAATCAGGTAAGCATCAACGGAGTTGAGATTCAGGTATTTTCT

AGTGAAAAAGGATTGGAGGTCTACCATGGTTCAGAACAGTTGTTGGCAATCAAAGAGCCATAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(16-97)

Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.

3D structure

Source	ID	Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.

Visualization of predicted probability:

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	H_a-value
comGE/cglE	Streptococcus pneumoniae Rx1	100	100	1
comGE/cglE	Streptococcus pneumoniae D39	100	100	1
comGE/cglE	Streptococcus pneumoniae R6	100	100	1
comGE/cglE	Streptococcus pneumoniae TIGR4	100	100	1
comGE/cglE	Streptococcus mitis NCTC 12261	98	100	0.98
comGE/cglE	Streptococcus mitis SK321	98	100	0.98
comYE	Streptococcus mutans UA140	44.444	90	0.4
comYE	Streptococcus mutans UA159	44.444	90	0.4

Detailed information NTG0863916