Detailed information    

insolico Bioinformatically predicted

Overview


Name   comGE   Type   Machinery gene
Locus tag   LLUC320_RS11075 Genome accession   NZ_CP129095
Coordinates   2156395..2156631 (-) Length   78 a.a.
NCBI ID   WP_014573335.1    Uniprot ID   -
Organism   Lactococcus cremoris strain UC320     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context


Location: 2151395..2161631
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LLUC320_RS11045 (LLUC320_11105) - 2152589..2153398 (-) 810 WP_011677177.1 metal ABC transporter permease -
  LLUC320_RS11050 (LLUC320_11110) - 2153391..2154128 (-) 738 WP_011677178.1 metal ABC transporter ATP-binding protein -
  LLUC320_RS11055 (LLUC320_11115) - 2154307..2155149 (-) 843 WP_011677179.1 metal ABC transporter solute-binding protein, Zn/Mn family -
  LLUC320_RS11060 (LLUC320_11120) - 2155146..2155583 (-) 438 WP_011677180.1 zinc-dependent MarR family transcriptional regulator -
  LLUC320_RS11065 (LLUC320_11125) comGG 2155663..2155890 (-) 228 WP_228764408.1 competence protein ComGG Machinery gene
  LLUC320_RS11070 (LLUC320_11130) comGF 2155986..2156411 (-) 426 WP_014735174.1 competence type IV pilus minor pilin ComGF Machinery gene
  LLUC320_RS11075 (LLUC320_11135) comGE 2156395..2156631 (-) 237 WP_014573335.1 competence type IV pilus minor pilin ComGE Machinery gene
  LLUC320_RS11080 (LLUC320_11140) comGD 2156663..2156851 (-) 189 WP_014573336.1 hypothetical protein Machinery gene
  LLUC320_RS11085 (LLUC320_11145) comGC 2157053..2157430 (-) 378 Protein_2156 competence type IV pilus major pilin ComGC -
  LLUC320_RS11090 (LLUC320_11150) comGB 2157448..2158473 (-) 1026 WP_050574185.1 competence type IV pilus assembly protein ComGB Machinery gene
  LLUC320_RS11095 (LLUC320_11155) comGA 2158373..2159353 (-) 981 WP_162494683.1 competence type IV pilus ATPase ComGA Machinery gene

Sequence


Protein


Download         Length: 78 a.a.        Molecular weight: 8700.94 Da        Isoelectric Point: 4.3885

>NTDB_id=850848 LLUC320_RS11075 WP_014573335.1 2156395..2156631(-) (comGE) [Lactococcus cremoris strain UC320]
MALLSFLVTFLLSALTNSRQQEVQENQQIESLNVAQMAIESQLMELSLNGSVIKIRQDSTATIISDHGKEILRLEAQN

Nucleotide


Download         Length: 237 bp        

>NTDB_id=850848 LLUC320_RS11075 WP_014573335.1 2156395..2156631(-) (comGE) [Lactococcus cremoris strain UC320]
ATGGCATTATTGAGCTTTTTGGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGTACAAGAAAATCA
ACAAATTGAGTCCTTAAATGTAGCTCAGATGGCAATAGAAAGTCAGCTGATGGAACTATCGTTAAATGGTTCTGTTATAA
AAATAAGACAAGATTCGACTGCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

96.154

100

0.962