NTDB

Overview

Name	comGE/cglE	Type	Machinery gene
Locus tag	QL280_RS09415	Genome accession	NZ_CP125291
Coordinates	1831109..1831411 (-)	Length	100 a.a.
NCBI ID	WP_000413382.1	Uniprot ID	-
Organism	Streptococcus pneumoniae strain 105_Kz
Function	dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1826109..1836411

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
QL280_RS09380 (QL280_09380)	rnpA	1826788..1827159 (-)	372	WP_000739246.1	ribonuclease P protein component	-
QL280_RS09385 (QL280_09385)	-	1827176..1827307 (-)	132	WP_000768904.1	hypothetical protein	-
QL280_RS09390 (QL280_09390)	-	1827308..1828498 (-)	1191	WP_000167766.1	acetate kinase	-
QL280_RS09395 (QL280_09395)	comYH	1828549..1829502 (-)	954	WP_000345101.1	class I SAM-dependent methyltransferase	Machinery gene
QL280_RS09400 (QL280_09400)	-	1829563..1830157 (-)	595	Protein_1830	methyltransferase domain-containing protein	-
QL280_RS09405 (QL280_09405)	comGG/cglG	1830294..1830707 (-)	414	WP_000265622.1	competence type IV pilus minor pilin ComGG	Machinery gene
QL280_RS09410 (QL280_09410)	comGF/cglF	1830685..1831146 (-)	462	WP_000250534.1	competence type IV pilus minor pilin ComGF	Machinery gene
QL280_RS09415 (QL280_09415)	comGE/cglE	1831109..1831411 (-)	303	WP_000413382.1	competence type IV pilus minor pilin ComGE	Machinery gene
QL280_RS09420 (QL280_09420)	comGD/cglD	1831374..1831778 (-)	405	WP_000588028.1	competence type IV pilus minor pilin ComGD	Machinery gene
QL280_RS09425 (QL280_09425)	comGC/cglC	1831771..1832097 (-)	327	WP_000738636.1	comG operon protein ComGC	Machinery gene
QL280_RS09430 (QL280_09430)	comGB/cglB	1832099..1833115 (-)	1017	WP_074017570.1	competence type IV pilus assembly protein ComGB	Machinery gene
QL280_RS09435 (QL280_09435)	comGA/cglA/cilD	1833063..1834004 (-)	942	WP_000249552.1	competence type IV pilus ATPase ComGA	Machinery gene
QL280_RS09440 (QL280_09440)	-	1834080..1834445 (-)	366	WP_000286415.1	DUF1033 family protein	-
QL280_RS09445 (QL280_09445)	-	1834596..1835654 (-)	1059	WP_000649468.1	zinc-dependent alcohol dehydrogenase family protein	-

Sequence

Protein

Download Length: 100 a.a. Molecular weight: 11108.08 Da Isoelectric Point: 9.7273

                                >NTDB_id=830853 QL280_RS09415 WP_000413382.1 1831109..1831411(-) (comGE/cglE) [Streptococcus pneumoniae strain 105_Kz]

MEKLNALRKQKIRAVILLEAVVALAIFASIATLLLGQIQKNRQEEAKILQKEEVLRVAKMALQTGQNQVSINGVEIQVFS

SEKGLEVYHGSEQLLAIKEP

Nucleotide

Download Length: 303 bp

                                >NTDB_id=830853 QL280_RS09415 WP_000413382.1 1831109..1831411(-) (comGE/cglE) [Streptococcus pneumoniae strain 105_Kz]

ATGGAAAAATTAAACGCATTAAGGAAACAAAAAATTAGGGCAGTGATTTTACTGGAAGCAGTAGTCGCTCTAGCTATCTT

TGCCAGCATTGCGACCCTCCTTTTGGGACAAATTCAAAAAAATAGGCAAGAGGAAGCAAAAATCTTGCAAAAGGAAGAAG

TCTTGAGGGTAGCTAAGATGGCCCTGCAGACGGGGCAAAATCAGGTAAGCATCAACGGAGTTGAGATTCAGGTATTTTCT

AGTGAAAAAGGATTGGAGGTCTACCATGGTTCAGAACAGTTGTTGGCAATCAAAGAGCCATAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(16-97)

Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.

3D structure

Source	ID	Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.

Visualization of predicted probability:

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	H_a-value
comGE/cglE	Streptococcus pneumoniae Rx1	100	100	1
comGE/cglE	Streptococcus pneumoniae D39	100	100	1
comGE/cglE	Streptococcus pneumoniae R6	100	100	1
comGE/cglE	Streptococcus pneumoniae TIGR4	100	100	1
comGE/cglE	Streptococcus mitis NCTC 12261	98	100	0.98
comGE/cglE	Streptococcus mitis SK321	98	100	0.98
comYE	Streptococcus mutans UA140	44.444	90	0.4
comYE	Streptococcus mutans UA159	44.444	90	0.4

Detailed information NTG0830853