Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   K6J91_RS02095 Genome accession   NZ_AP024624
Coordinates   416314..416436 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain BEST3106     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 411314..421436
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  K6J91_RS02080 (BsBEST3106_03670) yclJ 412928..413611 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  K6J91_RS02085 (BsBEST3106_03680) yclK 413598..415019 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  K6J91_RS02090 (BsBEST3106_03690) rapC 415182..416330 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  K6J91_RS02095 (BsBEST3106_03700) phrC 416314..416436 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  K6J91_RS02100 yczM 416536..416625 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  K6J91_RS02105 yczN 416707..416820 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  K6J91_RS02110 (BsBEST3106_03710) thrD 416974..418338 (-) 1365 WP_009966541.1 aspartate kinase -
  K6J91_RS02115 (BsBEST3106_03720) ceuB 418723..419673 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  K6J91_RS02120 (BsBEST3106_03730) yclO 419666..420613 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  K6J91_RS02125 (BsBEST3106_03740) yclP 420607..421365 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=73970 K6J91_RS02095 WP_003224994.1 416314..416436(+) (phrC) [Bacillus subtilis strain BEST3106]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=73970 K6J91_RS02095 WP_003224994.1 416314..416436(+) (phrC) [Bacillus subtilis strain BEST3106]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment