Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | LCZ91_RS03750 | Genome accession | NZ_CP084891 |
| Coordinates | 838194..838313 (+) | Length | 39 a.a. |
| NCBI ID | WP_033482837.1 | Uniprot ID | - |
| Organism | Xanthomonas citri pv. mangiferaeindicae strain GZ09 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 833194..843313
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LCZ91_RS03725 (LCZ91_03725) | pilC | 833777..835036 (-) | 1260 | WP_033483308.1 | type II secretion system F family protein | Machinery gene |
| LCZ91_RS03730 (LCZ91_03730) | comP | 835381..835809 (+) | 429 | WP_005921364.1 | pilin | Machinery gene |
| LCZ91_RS03740 (LCZ91_03740) | pilA2 | 835906..836319 (+) | 414 | WP_005921365.1 | pilin | Machinery gene |
| LCZ91_RS03745 (LCZ91_03745) | pilB | 836361..838097 (+) | 1737 | WP_033482835.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| LCZ91_RS03750 (LCZ91_03750) | pilB | 838194..838313 (+) | 120 | WP_033482837.1 | hypothetical protein | Machinery gene |
| LCZ91_RS03755 (LCZ91_03755) | - | 838445..838600 (+) | 156 | WP_003488595.1 | hypothetical protein | - |
| LCZ91_RS03760 (LCZ91_03760) | pilR | 838798..840192 (-) | 1395 | WP_003488597.1 | sigma-54 dependent transcriptional regulator | Regulator |
| LCZ91_RS03765 (LCZ91_03765) | - | 840521..842134 (-) | 1614 | WP_003488599.1 | HAMP domain-containing sensor histidine kinase | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4205.86 Da Isoelectric Point: 9.0113
>NTDB_id=613788 LCZ91_RS03750 WP_033482837.1 838194..838313(+) (pilB) [Xanthomonas citri pv. mangiferaeindicae strain GZ09]
MQIAEAAQAIGIRDLRQSALMKAAHGVTNLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTNLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=613788 LCZ91_RS03750 WP_033482837.1 838194..838313(+) (pilB) [Xanthomonas citri pv. mangiferaeindicae strain GZ09]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAACCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAACCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
48.718 |
100 |
0.487 |
| pilB | Acinetobacter baumannii D1279779 |
46.154 |
100 |
0.462 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |
| pilB | Vibrio cholerae strain A1552 |
42.857 |
89.744 |
0.385 |