Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | XAC29_RS39285 | Genome accession | NC_020800 |
| Coordinates | 3823344..3823463 (-) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas axonopodis Xac29-1 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Genomic island | 3799605..3823463 | 3823344..3823463 | within | 0 |
Gene organization within MGE regions
Location: 3799605..3823463
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| XAC29_RS39185 (XAC29_16405) | - | 3799605..3799934 (-) | 330 | WP_005918642.1 | hypothetical protein | - |
| XAC29_RS39190 (XAC29_16410) | - | 3800081..3800680 (+) | 600 | WP_015462601.1 | hypothetical protein | - |
| XAC29_RS39195 (XAC29_16415) | - | 3801007..3801456 (+) | 450 | WP_015462602.1 | hypothetical protein | - |
| XAC29_RS39200 (XAC29_16420) | - | 3801453..3802058 (+) | 606 | WP_011052963.1 | M48 family metalloprotease | - |
| XAC29_RS39205 (XAC29_16425) | - | 3802055..3802549 (+) | 495 | Protein_3244 | hypothetical protein | - |
| XAC29_RS47005 | - | 3802677..3803021 (-) | 345 | WP_075150220.1 | hypothetical protein | - |
| XAC29_RS39210 (XAC29_16430) | - | 3803064..3804341 (-) | 1278 | WP_011052966.1 | lytic murein transglycosylase | - |
| XAC29_RS39215 (XAC29_16435) | - | 3804474..3807464 (-) | 2991 | WP_011052967.1 | Tn3-like element TnXax1 family transposase | - |
| XAC29_RS39220 (XAC29_16440) | - | 3807472..3808746 (-) | 1275 | WP_011052968.1 | tyrosine-type recombinase/integrase | - |
| XAC29_RS39225 (XAC29_16445) | - | 3808938..3809993 (+) | 1056 | WP_015462603.1 | DNA-binding protein | - |
| XAC29_RS39230 | xopE | 3810126..3811202 (+) | 1077 | WP_041470856.1 | XopE/AvrPphe family type III secretion system effector | - |
| XAC29_RS39235 (XAC29_16455) | - | 3811533..3812614 (+) | 1082 | Protein_3251 | DNA-binding protein | - |
| XAC29_RS39240 (XAC29_16460) | xopAI | 3812748..3813638 (+) | 891 | WP_011052119.1 | type III secretion system effector XopAI | - |
| XAC29_RS39245 (XAC29_16465) | - | 3814058..3814864 (-) | 807 | WP_015463520.1 | hypothetical protein | - |
| XAC29_RS39250 (XAC29_16470) | - | 3814969..3815253 (+) | 285 | WP_016849322.1 | hypothetical protein | - |
| XAC29_RS39255 (XAC29_16475) | - | 3815481..3816596 (+) | 1116 | WP_011052122.1 | IS1595 family transposase | - |
| XAC29_RS48735 | - | 3816551..3817066 (-) | 516 | WP_011052123.1 | hypothetical protein | - |
| XAC29_RS39260 (XAC29_16480) | sucD | 3817153..3818028 (-) | 876 | WP_005921370.1 | succinate--CoA ligase subunit alpha | - |
| XAC29_RS39265 (XAC29_16485) | sucC | 3818053..3819222 (-) | 1170 | WP_005915812.1 | ADP-forming succinate--CoA ligase subunit beta | - |
| XAC29_RS39270 (XAC29_16490) | - | 3819454..3821067 (+) | 1614 | WP_003488599.1 | HAMP domain-containing sensor histidine kinase | - |
| XAC29_RS39275 (XAC29_16495) | pilR | 3821392..3822786 (+) | 1395 | WP_015463522.1 | sigma-54 dependent transcriptional regulator | Regulator |
| XAC29_RS39280 (XAC29_16500) | - | 3823045..3823212 (-) | 168 | WP_015463523.1 | hypothetical protein | - |
| XAC29_RS39285 (XAC29_16505) | pilB | 3823344..3823463 (-) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=57354 XAC29_RS39285 WP_005915819.1 3823344..3823463(-) (pilB) [Xanthomonas axonopodis Xac29-1]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=57354 XAC29_RS39285 WP_005915819.1 3823344..3823463(-) (pilB) [Xanthomonas axonopodis Xac29-1]
ATGCAGATCGCCGAGGCCGCGCAGGCGATCGGTATTCGCGATTTGCGCCAGTCGGCGTTGATGAAAGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCGCAGGCGATCGGTATTCGCGATTTGCGCCAGTCGGCGTTGATGAAAGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |