Detailed information
Overview
| Name | comS | Type | Regulator |
| Locus tag | - | Genome accession | HE613569 |
| Coordinates | 110367..110411 (+) | Length | 15 a.a. |
| NCBI ID | - | Uniprot ID | - |
| Organism | Streptococcus macedonicus ACA-DC 198 | ||
| Function | activate transcription of comX; activate transcription of comS (predicted from homology) Competence regulation |
||
Genomic Context
Location: 105367..115411
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| SMA_0100 | ackA | 106320..107519 (+) | 1200 | CCF01391.1 | Acetate kinase | - |
| SMA_0101 | - | 107681..107881 (+) | 201 | CCF01392.1 | Transcriptional regulator, Cro/CI family | - |
| SMA_0102 | - | 107891..108100 (+) | 210 | CCF01393.1 | Hypothetical protein | - |
| SMA_0103 | - | 108113..108565 (+) | 453 | CCF01394.1 | Hypothetical protein | - |
| SMA_0104 | - | 108577..109212 (+) | 636 | CCF01395.1 | Membrane-bound protease, CAAX family | - |
| SMA_0105 | comR | 109391..110290 (+) | 900 | CCF01396.1 | Transcriptional regulator | Regulator |
| - | comS | 110367..110411 (+) | 45 | - | - | Regulator |
| SMA_0106 | purD | 110764..112026 (+) | 1263 | CCF01397.1 | Phosphoribosylamine--glycine ligase | - |
| SMA_0107 | ybbK | 112016..112465 (+) | 450 | CCF01398.1 | Hypothetical protein | - |
| SMA_0108 | purE | 112465..112953 (+) | 489 | CCF01399.1 | Phosphoribosylaminoimidazole carboxylase catalytic subunit | - |
| SMA_0109 | purK | 112940..114031 (+) | 1092 | CCF01400.1 | Phosphoribosylaminoimidazole carboxylase ATPase subunit | - |
| SMA_0110 | - | 114051..114329 (+) | 279 | CCF01401.1 | Hypothetical protein | - |
Sequence
Protein
Download Length: 15 a.a. Molecular weight: 1798.22 Da Isoelectric Point: 9.1500
>NTDB_id=564 110367..110411(+) (comS) [Streptococcus macedonicus ACA-DC 198]
MLKFFSIVITGWWGL
MLKFFSIVITGWWGL
Nucleotide
Download Length: 45 bp
>NTDB_id=564 110367..110411(+) (comS) [Streptococcus macedonicus ACA-DC 198]
ATGCTAAAATTTTTTTCAATTGTTATAACTGGTTGGTGGGGATTA
ATGCTAAAATTTTTTTCAATTGTTATAACTGGTTGGTGGGGATTA
XIP
This gene is known to encode the precursor of σX inducing peptide (XIP), which involves in competence development. The mature XIP sequence is displayed as below:
ITGWWGL
Domains
No domain identified.
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comS | Streptococcus infantarius subsp. infantarius ATCC BAA-102 |
60 |
100 |
0.6 |
| djlA | Legionella pneumophila str. Paris |
72.727 |
73.333 |
0.533 |
| djlA | Legionella pneumophila strain ERS1305867 |
72.727 |
73.333 |
0.533 |