Detailed information    

experimental Experimentally validated

Overview

Name   comS   Type   Regulator
Locus tag   - Genome accession   NZ_DS572685
Coordinates   24832..24876 (+) Length   15 a.a.
NCBI ID   - Uniprot ID   -
Organism   Streptococcus infantarius subsp. infantarius ATCC BAA-102     
Function   activate transcription of comX; activate transcription of comS   
Competence regulation

Function

Deletion of comR comS eliminated both endogenous expression of competence and response to synthetic peptide.


Genomic Context

Location: 19832..29876
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  STRINF_RS01845 (STRINF_00389) - 20204..20610 (+) 407 Protein_16 DUF523 domain-containing protein -
  STRINF_RS01850 (STRINF_00390) purE 20610..21098 (+) 489 WP_006531305.1 5-(carboxyamino)imidazole ribonucleotide mutase -
  STRINF_RS01855 (STRINF_00391) purK 21085..22176 (+) 1092 WP_006531306.1 5-(carboxyamino)imidazole ribonucleotide synthase -
  STRINF_RS10415 - 22179..22274 (+) 96 Protein_19 phosphoribosylaminoimidazole carboxylase -
  STRINF_RS01860 (STRINF_00392) purB 22364..23662 (+) 1299 WP_006531307.1 adenylosuccinate lyase -
  STRINF_RS01865 (STRINF_00393) comR 23851..24729 (+) 879 WP_174221231.1 helix-turn-helix domain-containing protein Regulator
  - comS 24832..24876 (+) 45 - - Regulator
  STRINF_RS01870 (STRINF_00395) ruvB 24931..25929 (+) 999 WP_006531310.1 Holliday junction branch migration DNA helicase RuvB -
  STRINF_RS10420 (STRINF_00396) - 26102..26308 (+) 207 WP_006531311.1 DUF7010 family protein -
  STRINF_RS10865 (STRINF_00397) - 26268..26633 (+) 366 WP_398577259.1 DUF7010 family protein -
  STRINF_RS01880 (STRINF_00398) - 26872..27303 (+) 432 Protein_25 low molecular weight protein-tyrosine-phosphatase -
  STRINF_RS01885 (STRINF_00399) - 27321..27701 (+) 381 WP_006531314.1 membrane protein -
  STRINF_RS01890 (STRINF_00400) - 27698..29491 (+) 1794 WP_006531315.1 acyltransferase family protein -

Regulatory network

Positive effect      
Negative effect
Regulator Target Regulation
  comS comC/comC1 positive effect
  comS comE/comE1 positive effect
  comR comC/comC1 positive effect
  comR comE/comE1 positive effect

Sequence

Protein


Download         Length: 15 a.a.        Molecular weight: 1736.15 Da        Isoelectric Point: 9.1500

>NTDB_id=556 24832..24876(+) (comS) [Streptococcus infantarius subsp. infantarius ATCC BAA-102]
MLKGFTVLLTAWWGL

Nucleotide


Download         Length: 45 bp        

>NTDB_id=556 24832..24876(+) (comS) [Streptococcus infantarius subsp. infantarius ATCC BAA-102]
ATGTTAAAGGGATTTACGGTTTTATTGACAGCCTGGTGGGGATTG

XIP

This gene is known to encode the precursor of σX inducing peptide (XIP), which involves in competence development. The mature XIP sequence is displayed as below:

LTAWWGL


Domains


No domain identified.



Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value

References

[1] Donald A Morrison et al. (2013) Competence for natural genetic transformation in the Streptococcus bovis group streptococci S. infantarius and S. macedonicus. Journal of Bacteriology 195(11):2612-20. [PMID: 23543718]