Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   LLUC047_RS12245 Genome accession   NZ_CP068658
Coordinates   2341346..2341582 (-) Length   78 a.a.
NCBI ID   WP_014573335.1    Uniprot ID   -
Organism   Lactococcus cremoris strain UC047     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2336346..2346582
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LLUC047_RS12215 (LLUC047_11925) - 2337540..2338349 (-) 810 WP_011677177.1 metal ABC transporter permease -
  LLUC047_RS12220 (LLUC047_11930) - 2338342..2339079 (-) 738 WP_011677178.1 metal ABC transporter ATP-binding protein -
  LLUC047_RS12225 (LLUC047_11935) - 2339258..2340100 (-) 843 WP_021216263.1 metal ABC transporter solute-binding protein, Zn/Mn family -
  LLUC047_RS12230 (LLUC047_11940) - 2340097..2340534 (-) 438 WP_011677180.1 zinc-dependent MarR family transcriptional regulator -
  LLUC047_RS12235 (LLUC047_11945) comGG 2340614..2340913 (-) 300 WP_011677181.1 competence type IV pilus minor pilin ComGG Machinery gene
  LLUC047_RS12240 (LLUC047_11950) comGF 2340937..2341362 (-) 426 WP_021216262.1 competence type IV pilus minor pilin ComGF Machinery gene
  LLUC047_RS12245 (LLUC047_11955) comGE 2341346..2341582 (-) 237 WP_014573335.1 competence type IV pilus minor pilin ComGE Machinery gene
  LLUC047_RS12250 (LLUC047_14310) comGD 2341614..2341802 (-) 189 WP_014573336.1 hypothetical protein Machinery gene
  LLUC047_RS12255 (LLUC047_11965) comGC 2342004..2342354 (-) 351 WP_050574401.1 competence type IV pilus major pilin ComGC Machinery gene
  LLUC047_RS12260 (LLUC047_11970) comGB 2342399..2343424 (-) 1026 WP_050574400.1 competence type IV pilus assembly protein ComGB Machinery gene
  LLUC047_RS12265 (LLUC047_11975) - 2343324..2344145 (-) 822 Protein_2386 ATPase, T2SS/T4P/T4SS family -
  LLUC047_RS12270 (LLUC047_11980) - 2344248..2345138 (+) 891 WP_205536422.1 IS982 family transposase -
  LLUC047_RS12275 (LLUC047_11985) comGA 2345120..2345311 (-) 192 WP_014573341.1 hypothetical protein Machinery gene

Sequence

Protein


Download         Length: 78 a.a.        Molecular weight: 8700.94 Da        Isoelectric Point: 4.3885

>NTDB_id=530277 LLUC047_RS12245 WP_014573335.1 2341346..2341582(-) (comGE) [Lactococcus cremoris strain UC047]
MALLSFLVTFLLSALTNSRQQEVQENQQIESLNVAQMAIESQLMELSLNGSVIKIRQDSTATIISDHGKEILRLEAQN

Nucleotide


Download         Length: 237 bp        

>NTDB_id=530277 LLUC047_RS12245 WP_014573335.1 2341346..2341582(-) (comGE) [Lactococcus cremoris strain UC047]
ATGGCATTATTGAGCTTTTTGGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGTACAAGAAAATCA
ACAAATTGAGTCCTTAAATGTAGCTCAGATGGCAATAGAAAGTCAGCTGATGGAACTATCGTTAAATGGTTCTGTTATAA
AAATAAGACAAGATTCGACTGCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG

Domains

Predicted by InterProScan.

Type II secretory pathway pseudopilin (ComGE)

(1-74)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

96.154

100

0.962