Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | H8Z70_RS05255 | Genome accession | NZ_CP060460 |
| Coordinates | 1228308..1228427 (+) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri pv. citri strain DAR84832 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Genomic island | 1228656..1250293 | 1228308..1228427 | flank | 229 |
Gene organization within MGE regions
Location: 1228308..1250293
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| H8Z70_RS05255 (H8Z70_05255) | pilB | 1228308..1228427 (+) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
| H8Z70_RS05260 (H8Z70_05260) | - | 1228559..1228726 (+) | 168 | WP_015463523.1 | hypothetical protein | - |
| H8Z70_RS05265 (H8Z70_05265) | pilR | 1228949..1230343 (-) | 1395 | WP_005930970.1 | sigma-54 dependent transcriptional regulator | Regulator |
| H8Z70_RS05270 (H8Z70_05270) | - | 1230668..1232281 (-) | 1614 | WP_003488599.1 | HAMP domain-containing sensor histidine kinase | - |
| H8Z70_RS05275 (H8Z70_05275) | sucC | 1232513..1233682 (+) | 1170 | WP_005915812.1 | ADP-forming succinate--CoA ligase subunit beta | - |
| H8Z70_RS05280 (H8Z70_05280) | sucD | 1233707..1234582 (+) | 876 | WP_005921370.1 | succinate--CoA ligase subunit alpha | - |
| H8Z70_RS23430 | - | 1234702..1234851 (-) | 150 | WP_157380096.1 | hypothetical protein | - |
| H8Z70_RS05290 (H8Z70_05290) | - | 1235139..1236254 (-) | 1116 | WP_011052122.1 | IS1595 family transposase | - |
| H8Z70_RS05295 (H8Z70_05295) | - | 1236482..1236766 (-) | 285 | WP_016849322.1 | hypothetical protein | - |
| H8Z70_RS05305 (H8Z70_05305) | xopAI | 1238097..1238987 (-) | 891 | WP_076605129.1 | type III secretion system effector XopAI | - |
| H8Z70_RS05310 (H8Z70_05310) | - | 1239121..1240223 (-) | 1103 | Protein_1039 | DNA-binding protein | - |
| H8Z70_RS05315 (H8Z70_05315) | xopE | 1240554..1241630 (-) | 1077 | WP_041471283.1 | XopE/AvrPphe family type III secretion system effector | - |
| H8Z70_RS05320 (H8Z70_05320) | - | 1241764..1242847 (-) | 1084 | Protein_1041 | DNA-binding protein | - |
| H8Z70_RS05325 (H8Z70_05325) | - | 1243040..1244313 (+) | 1274 | Protein_1042 | site-specific integrase | - |
| H8Z70_RS05330 (H8Z70_05330) | - | 1244322..1247312 (+) | 2991 | WP_015472512.1 | Tn3 family transposase | - |
| H8Z70_RS05335 (H8Z70_05335) | - | 1247445..1248722 (+) | 1278 | WP_005919631.1 | lytic murein transglycosylase | - |
| H8Z70_RS05340 (H8Z70_05340) | avrXacE2 | 1248807..1249877 (+) | 1071 | WP_011052114.1 | type III secretion system effector avirulence protein AvrXacE2 | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=476246 H8Z70_RS05255 WP_005915819.1 1228308..1228427(+) (pilB) [Xanthomonas citri pv. citri strain DAR84832]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=476246 H8Z70_RS05255 WP_005915819.1 1228308..1228427(+) (pilB) [Xanthomonas citri pv. citri strain DAR84832]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |