Detailed information
Bioinformatically predicted
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | H8Z73_RS16700 | Genome accession | NZ_CP060446 |
| Coordinates | 3871542..3871661 (-) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri pv. citri strain DAR72029 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Genomic island | 3850115..3884237 | 3871542..3871661 | within | 0 |
Gene organization within MGE regions
Location: 3850115..3884237
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| H8Z73_RS16620 (H8Z73_16625) | avrXacE2 | 3850115..3851185 (-) | 1071 | WP_011052114.1 | type III secretion system effector avirulence protein AvrXacE2 | - |
| H8Z73_RS16625 (H8Z73_16630) | - | 3851270..3852547 (-) | 1278 | WP_052462048.1 | lytic murein transglycosylase | - |
| H8Z73_RS16630 (H8Z73_16635) | - | 3852681..3855671 (-) | 2991 | WP_015472512.1 | Tn3 family transposase | - |
| H8Z73_RS16635 (H8Z73_16640) | - | 3855680..3856953 (-) | 1274 | Protein_3263 | site-specific integrase | - |
| H8Z73_RS16640 (H8Z73_16645) | - | 3857147..3858244 (+) | 1098 | WP_088016277.1 | DNA-binding protein | - |
| H8Z73_RS16645 (H8Z73_16650) | xopE | 3858378..3859454 (+) | 1077 | WP_041471283.1 | XopE/AvrPphe family type III secretion system effector | - |
| H8Z73_RS16650 (H8Z73_16655) | - | 3859785..3860866 (+) | 1082 | Protein_3266 | DNA-binding protein | - |
| H8Z73_RS16655 (H8Z73_16660) | xopAI | 3861000..3861890 (+) | 891 | WP_011052119.1 | type III secretion system effector XopAI | - |
| H8Z73_RS16660 (H8Z73_16665) | - | 3863221..3863505 (+) | 285 | WP_016849322.1 | hypothetical protein | - |
| H8Z73_RS16665 (H8Z73_16670) | - | 3863733..3864848 (+) | 1116 | WP_011052122.1 | IS1595 family transposase | - |
| H8Z73_RS16670 (H8Z73_16675) | - | 3865136..3865285 (+) | 150 | WP_157380096.1 | hypothetical protein | - |
| H8Z73_RS16675 (H8Z73_16680) | sucD | 3865405..3866280 (-) | 876 | WP_005921370.1 | succinate--CoA ligase subunit alpha | - |
| H8Z73_RS16680 (H8Z73_16685) | sucC | 3866305..3867474 (-) | 1170 | WP_005915812.1 | ADP-forming succinate--CoA ligase subunit beta | - |
| H8Z73_RS16685 (H8Z73_16690) | - | 3867706..3869319 (+) | 1614 | WP_003488599.1 | HAMP domain-containing sensor histidine kinase | - |
| H8Z73_RS16690 (H8Z73_16695) | pilR | 3869644..3871038 (+) | 1395 | WP_005930970.1 | sigma-54 dependent transcriptional regulator | Regulator |
| H8Z73_RS16695 (H8Z73_16700) | - | 3871243..3871410 (-) | 168 | WP_015463523.1 | hypothetical protein | - |
| H8Z73_RS16700 (H8Z73_16705) | pilB | 3871542..3871661 (-) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
| H8Z73_RS16705 (H8Z73_16710) | pilB | 3872155..3873891 (-) | 1737 | WP_011052125.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| H8Z73_RS16710 (H8Z73_16715) | - | 3873955..3874410 (-) | 456 | WP_015463526.1 | pilin | - |
| H8Z73_RS16715 (H8Z73_16720) | - | 3874520..3874960 (-) | 441 | WP_015471735.1 | pilin | - |
| H8Z73_RS16720 (H8Z73_16725) | pilC | 3875318..3876574 (+) | 1257 | WP_040107659.1 | type II secretion system F family protein | Machinery gene |
| H8Z73_RS16725 (H8Z73_16730) | - | 3876581..3877444 (+) | 864 | WP_003491180.1 | A24 family peptidase | - |
| H8Z73_RS16730 (H8Z73_16735) | coaE | 3877458..3878066 (+) | 609 | WP_011052129.1 | dephospho-CoA kinase | - |
| H8Z73_RS16735 (H8Z73_16740) | - | 3878290..3882813 (+) | 4524 | WP_040153736.1 | RHS repeat domain-containing protein | - |
| H8Z73_RS16740 (H8Z73_16745) | - | 3883448..3883813 (+) | 366 | WP_076605127.1 | SymE family type I addiction module toxin | - |
| H8Z73_RS16745 (H8Z73_16750) | - | 3883827..3884072 (+) | 246 | Protein_3285 | transposase | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=476215 H8Z73_RS16700 WP_005915819.1 3871542..3871661(-) (pilB) [Xanthomonas citri pv. citri strain DAR72029]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=476215 H8Z73_RS16700 WP_005915819.1 3871542..3871661(-) (pilB) [Xanthomonas citri pv. citri strain DAR72029]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |