Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   H0A38_RS11115 Genome accession   NZ_CP059048
Coordinates   2255448..2255744 (-) Length   98 a.a.
NCBI ID   WP_033900709.1    Uniprot ID   A0A0H1RKN4
Organism   Lactococcus lactis strain LAC460     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2250448..2260744
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  H0A38_RS11080 (H0A38_11020) - 2250739..2251605 (+) 867 WP_058204413.1 RluA family pseudouridine synthase -
  H0A38_RS11085 (H0A38_11025) - 2251643..2252452 (-) 810 WP_014570791.1 metal ABC transporter permease -
  H0A38_RS11090 (H0A38_11030) - 2252445..2253182 (-) 738 WP_012898617.1 metal ABC transporter ATP-binding protein -
  H0A38_RS11095 (H0A38_11035) - 2253359..2254201 (-) 843 WP_015427160.1 metal ABC transporter substrate-binding protein -
  H0A38_RS11100 (H0A38_11040) - 2254198..2254635 (-) 438 WP_010906313.1 zinc-dependent MarR family transcriptional regulator -
  H0A38_RS11105 (H0A38_11045) comGG 2254716..2255000 (-) 285 WP_017865155.1 competence type IV pilus minor pilin ComGG Machinery gene
  H0A38_RS11110 (H0A38_11050) comGF 2255039..2255485 (-) 447 WP_165379808.1 competence type IV pilus minor pilin ComGF Machinery gene
  H0A38_RS11115 (H0A38_11055) comGE 2255448..2255744 (-) 297 WP_033900709.1 competence type IV pilus minor pilin ComGE Machinery gene
  H0A38_RS11120 (H0A38_11060) comGD 2255716..2256147 (-) 432 WP_226319344.1 competence type IV pilus minor pilin ComGD Machinery gene
  H0A38_RS11125 (H0A38_11065) comGC 2256107..2256490 (-) 384 WP_012898622.1 competence type IV pilus major pilin ComGC Machinery gene
  H0A38_RS11130 (H0A38_11070) comGB 2256504..2257577 (-) 1074 WP_080735950.1 competence type IV pilus assembly protein ComGB Machinery gene
  H0A38_RS11135 (H0A38_11075) comGA 2257471..2258409 (-) 939 WP_033900707.1 competence type IV pilus ATPase ComGA Machinery gene

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11048.89 Da        Isoelectric Point: 5.6957

>NTDB_id=466780 H0A38_RS11115 WP_033900709.1 2255448..2255744(-) (comGE) [Lactococcus lactis strain LAC460]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMQLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=466780 H0A38_RS11115 WP_033900709.1 2255448..2255744(-) (comGE) [Lactococcus lactis strain LAC460]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCATTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGGAAGGAAATTATGCAACTTGAACTTCAAAGTTAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB A0A0H1RKN4

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

67.01

98.98

0.663