Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   G4P54_RS02080 Genome accession   NZ_CP048852
Coordinates   406216..406338 (+) Length   40 a.a.
NCBI ID   WP_024714533.1    Uniprot ID   -
Organism   Bacillus tequilensis strain EA-CB0015     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 401216..411338
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  G4P54_RS02060 (G4P54_02055) - 402058..403281 (+) 1224 WP_167871625.1 Ger(x)C family spore germination protein -
  G4P54_RS02065 (G4P54_02060) - 403306..404430 (+) 1125 WP_024714535.1 GerAB/ArcD/ProY family transporter -
  G4P54_RS21590 - 404479..404630 (-) 152 Protein_364 ABC transporter permease -
  G4P54_RS02070 (G4P54_02065) - 404787..404921 (+) 135 Protein_365 ATP-binding protein -
  G4P54_RS02075 (G4P54_02070) rapC 405084..406232 (+) 1149 WP_167871626.1 response regulator aspartate phosphatase RapC Regulator
  G4P54_RS02080 (G4P54_02075) phrC 406216..406338 (+) 123 WP_024714533.1 phosphatase RapC inhibitor PhrC Regulator
  G4P54_RS02085 (G4P54_02080) - 406439..406528 (-) 90 WP_167871627.1 YjcZ family sporulation protein -
  G4P54_RS02090 (G4P54_02085) - 406711..408075 (-) 1365 WP_167871628.1 aspartate kinase -
  G4P54_RS02095 (G4P54_02090) ceuB 408461..409411 (+) 951 WP_024714530.1 petrobactin ABC transporter permease YclN Machinery gene
  G4P54_RS02100 (G4P54_02095) yclO 409404..410351 (+) 948 WP_167871629.1 petrobactin ABC transporter permease YclO -
  G4P54_RS02105 (G4P54_02100) yclP 410345..411103 (+) 759 WP_167871630.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=423535 G4P54_RS02080 WP_024714533.1 406216..406338(+) (phrC) [Bacillus tequilensis strain EA-CB0015]
MKLKSKLFVICFAAAAILTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=423535 G4P54_RS02080 WP_024714533.1 406216..406338(+) (phrC) [Bacillus tequilensis strain EA-CB0015]
ATGAAGTTGAAATCTAAGTTGTTTGTTATTTGTTTTGCCGCCGCCGCGATTCTTACAGCGGCAGGTGTTTCCGCTAACGC
CGAAGCACTCGACTTTCATGTAACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

95

100

0.95