Detailed information NTG0314101

Bioinformatically predicted

Overview

• Name: comGE
• Type: Machinery gene
• Locus tag: LL1196_RS12115
• Genome accession: NZ_CP032148
• Coordinates: 2313443..2313739 (-)
• Length: 98 a.a.
• NCBI ID: WP_021164977.1
• Uniprot ID: A0A2Z5Z499
• Organism: Lactococcus cremoris strain 1196
• Function: dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type	MGE coordinates	Gene coordinates	Relative position	Distance (bp)
IScluster/Tn	2314551..2318953	2313443..2313739	flank	812

Gene organization within MGE regions

Location: 2313443..2318953

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
LL1196_RS12115 (LL1196_2427)	comGE	2313443..2313739 (-)	297	WP_021164977.1	competence type IV pilus minor pilin ComGE	Machinery gene
LL1196_RS12120 (LL1196_03780)	comGD	2313711..2313899 (-)	189	WP_014573336.1	hypothetical protein	Machinery gene
LL1196_RS12125 (LL1196_2428)	comGC	2314101..2314451 (-)	351	WP_050574401.1	competence type IV pilus major pilin ComGC	Machinery gene
LL1196_RS12130 (LL1196_2429)	comGB	2314496..2315521 (-)	1026	WP_050574400.1	competence type IV pilus assembly protein ComGB	Machinery gene
LL1196_RS12135 (LL1196_2430)	-	2315421..2316242 (-)	822	Protein_2361	ATPase, T2SS/T4P/T4SS family	-
LL1196_RS12140 (LL1196_2431)	-	2316345..2317235 (+)	891	WP_205536422.1	IS982 family transposase	-
LL1196_RS12145 (LL1196_2432)	comGA	2317217..2317408 (-)	192	WP_014573341.1	hypothetical protein	Machinery gene

Sequence

Protein

• Length: 98 a.a.
• Molecular weight: 10958.72 Da
• Isoelectric Point: 5.0658

>NTDB_id=314101 LL1196_RS12115 WP_021164977.1 2313443..2313739(-) (comGE) [Lactococcus cremoris strain 1196]
MENIKRKSIKGCILLESLISMALLSFLVTFLLSALTNSRQQEVQENQQIESLNVAQMAIESQLMELSLNGSVIKIRQDST
ATIISDHGKEILRLEAQN

Nucleotide

• Length: 297 bp

>NTDB_id=314101 LL1196_RS12115 WP_021164977.1 2313443..2313739(-) (comGE) [Lactococcus cremoris strain 1196]
GTGGAAAATATAAAAAGAAAATCAATTAAGGGATGTATACTTCTTGAGAGCCTAATTAGTATGGCATTATTGAGCTTTTT
GGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGTACAAGAAAATCAACAAATTGAGTCCTTAAATG
TAGCTCAGATGGCAATAGAAAGTCAGCTGATGGAACTATCGTTAAATGGTTCTGTTATAAAAATAAGACAAGATTCGACT
GCAACCATTATTAGTGATCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG

Domains

Predicted by InterproScan.

• Type II secretory pathway pseudopilin (ComGE) (13-94)

3D structure

• AlphaFold DB: A0A2Z5Z499

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
comGE	Lactococcus lactis subsp. cremoris KW2	95.918	100	0.959