Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | B7L66_RS04405 | Genome accession | NZ_CP020885 |
| Coordinates | 947543..947662 (+) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri pv. citri strain TX160149 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Genomic island | 947891..966936 | 947543..947662 | flank | 229 |
Gene organization within MGE regions
Location: 947543..966936
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| B7L66_RS04405 (B7L66_04395) | pilB | 947543..947662 (+) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
| B7L66_RS04410 (B7L66_04400) | - | 947794..947961 (+) | 168 | WP_015463523.1 | hypothetical protein | - |
| B7L66_RS04415 (B7L66_04405) | pilR | 948220..949614 (-) | 1395 | WP_005930970.1 | sigma-54 dependent transcriptional regulator | Regulator |
| B7L66_RS04420 (B7L66_04410) | - | 949939..951552 (-) | 1614 | WP_003488599.1 | HAMP domain-containing sensor histidine kinase | - |
| B7L66_RS04425 (B7L66_04415) | sucC | 951784..952953 (+) | 1170 | WP_005915812.1 | ADP-forming succinate--CoA ligase subunit beta | - |
| B7L66_RS04430 (B7L66_04420) | sucD | 952978..953853 (+) | 876 | WP_005921370.1 | succinate--CoA ligase subunit alpha | - |
| B7L66_RS26755 | - | 953973..954122 (-) | 150 | WP_157380096.1 | hypothetical protein | - |
| B7L66_RS26760 | - | 954572..955090 (-) | 519 | Protein_829 | IS1595 family transposase | - |
| B7L66_RS27140 | - | 955380..955526 (-) | 147 | Protein_830 | DDE transposase | - |
| B7L66_RS04445 (B7L66_04435) | - | 955754..956038 (-) | 285 | WP_235652377.1 | hypothetical protein | - |
| B7L66_RS04450 (B7L66_04440) | - | 956143..956949 (+) | 807 | WP_015463520.1 | hypothetical protein | - |
| B7L66_RS04455 (B7L66_04445) | xopAI | 957369..958259 (-) | 891 | WP_011052119.1 | type III secretion system effector XopAI | - |
| B7L66_RS04460 (B7L66_04450) | - | 958393..959490 (-) | 1098 | WP_088016277.1 | DNA-binding protein | - |
| B7L66_RS04470 (B7L66_04460) | - | 959683..960956 (+) | 1274 | Protein_835 | site-specific integrase | - |
| B7L66_RS04475 (B7L66_04465) | - | 960965..963955 (+) | 2991 | WP_088016278.1 | Tn3-like element TnXax1 family transposase | - |
| B7L66_RS04480 (B7L66_04470) | - | 964088..965365 (+) | 1278 | WP_088016279.1 | lytic murein transglycosylase | - |
| B7L66_RS04485 (B7L66_04475) | avrXacE2 | 965450..966520 (+) | 1071 | WP_011052114.1 | type III secretion system effector avirulence protein AvrXacE2 | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=226891 B7L66_RS04405 WP_005915819.1 947543..947662(+) (pilB) [Xanthomonas citri pv. citri strain TX160149]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=226891 B7L66_RS04405 WP_005915819.1 947543..947662(+) (pilB) [Xanthomonas citri pv. citri strain TX160149]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |