Detailed information NTG0211013

Bioinformatically predicted

Overview

• Name: pilB
• Type: Machinery gene
• Locus tag: BI315_RS07345
• Genome accession: NZ_CP018850
• Coordinates: 1652144..1652263 (-)
• Length: 39 a.a.
• NCBI ID: WP_005915819.1
• Uniprot ID: A0A7S6YV99
• Organism: Xanthomonas citri pv. citri strain LJ207-7
• Function: power the assembly of type IV pilus (predicted from homology) DNA binding and uptake

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type	MGE coordinates	Gene coordinates	Relative position	Distance (bp)
Genomic island	1628801..1656318	1652144..1652263	within	0

Gene organization within MGE regions

Location: 1628801..1656318

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
BI315_RS07250 (BI315_07240)	-	1628801..1629968 (+)	1168	Protein_1350	IS3 family transposase	-
BI315_RS07260 (BI315_07250)	avrXacE2	1630728..1631798 (-)	1071	WP_011052114.1	type III secretion system effector avirulence protein AvrXacE2	-
BI315_RS07265 (BI315_07255)	-	1631884..1633161 (-)	1278	WP_011052115.1	lytic murein transglycosylase	-
BI315_RS07270 (BI315_07260)	-	1633294..1636284 (-)	2991	WP_075155145.1	Tn3-like element TnXax1 family transposase	-
BI315_RS07275 (BI315_07265)	-	1636292..1637566 (-)	1275	WP_011052968.1	tyrosine-type recombinase/integrase	-
BI315_RS07280 (BI315_07270)	-	1637759..1638828 (+)	1070	Protein_1355	DNA-binding protein	-
BI315_RS07285 (BI315_07275)	xopE	1638962..1640038 (+)	1077	WP_075155146.1	XopE/AvrPphe family type III secretion system effector	-
BI315_RS07290 (BI315_07280)	-	1640369..1641450 (+)	1082	Protein_1357	DNA-binding protein	-
BI315_RS07295 (BI315_07285)	xopAI	1641584..1642474 (+)	891	WP_011052119.1	type III secretion system effector XopAI	-
BI315_RS07305 (BI315_07295)	-	1643805..1644089 (+)	285	WP_016849322.1	hypothetical protein	-
BI315_RS07310 (BI315_07300)	-	1644317..1645432 (+)	1116	WP_011052122.1	IS1595 family transposase	-
BI315_RS07315 (BI315_07305)	-	1645387..1645902 (-)	516	WP_011052123.1	hypothetical protein	-
BI315_RS07320 (BI315_07310)	sucD	1645989..1646864 (-)	876	WP_005921370.1	succinate--CoA ligase subunit alpha	-
BI315_RS07325 (BI315_07315)	sucC	1646889..1648058 (-)	1170	WP_005915812.1	ADP-forming succinate--CoA ligase subunit beta	-
BI315_RS07330 (BI315_07320)	-	1648290..1649903 (+)	1614	WP_003488599.1	HAMP domain-containing sensor histidine kinase	-
BI315_RS07335 (BI315_07325)	pilR	1650228..1651622 (+)	1395	WP_015463522.1	sigma-54 dependent transcriptional regulator	Regulator
BI315_RS07340 (BI315_07330)	-	1651845..1652012 (-)	168	WP_015463523.1	hypothetical protein	-
BI315_RS07345 (BI315_07335)	pilB	1652144..1652263 (-)	120	WP_005915819.1	hypothetical protein	Machinery gene
BI315_RS07355 (BI315_07345)	pilB	1652757..1654493 (-)	1737	WP_011052125.1	type IV-A pilus assembly ATPase PilB	Machinery gene
BI315_RS07360 (BI315_07350)	-	1654557..1655012 (-)	456	WP_015463526.1	pilin	-
BI315_RS07365 (BI315_07355)	-	1655122..1655562 (-)	441	WP_011052127.1	pilin	-

Sequence

Protein

• Length: 39 a.a.
• Molecular weight: 4178.84 Da
• Isoelectric Point: 9.0113

>NTDB_id=211013 BI315_RS07345 WP_005915819.1 1652144..1652263(-) (pilB) [Xanthomonas citri pv. citri strain LJ207-7]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD

Nucleotide

• Length: 120 bp

>NTDB_id=211013 BI315_RS07345 WP_005915819.1 1652144..1652263(-) (pilB) [Xanthomonas citri pv. citri strain LJ207-7]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA

Domains

No domain identified.

3D structure

• AlphaFold DB: A0A7S6YV99

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
pilB	Acinetobacter baylyi ADP1	51.282	100	0.513
pilB	Acinetobacter baumannii D1279779	48.718	100	0.487
pilB	Vibrio cholerae strain A1552	45.714	89.744	0.41
pilB	Legionella pneumophila strain ERS1305867	38.462	100	0.385