Detailed information
Bioinformatically predicted
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | BGK55_RS05695 | Genome accession | NZ_CP017020 |
| Coordinates | 1265939..1266058 (+) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri pv. malvacearum strain MSCT | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 1260939..1271058
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| BGK55_RS25165 (BGK55_05665) | - | 1261233..1261517 (+) | 285 | WP_232515052.1 | SMR family transporter | - |
| BGK55_RS05675 (BGK55_05670) | - | 1261522..1262316 (+) | 795 | WP_005915828.1 | glycosyltransferase | - |
| BGK55_RS05680 (BGK55_05675) | - | 1262331..1263359 (+) | 1029 | WP_234787234.1 | glycosyltransferase | - |
| BGK55_RS05685 (BGK55_05680) | - | 1263352..1264008 (+) | 657 | WP_157733690.1 | methionine biosynthesis protein MetW | - |
| BGK55_RS05690 (BGK55_05685) | pilB | 1264106..1265842 (+) | 1737 | WP_005915821.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| BGK55_RS05695 (BGK55_05690) | pilB | 1265939..1266058 (+) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
| BGK55_RS22440 | - | 1266214..1266357 (+) | 144 | WP_005915817.1 | hypothetical protein | - |
| BGK55_RS05700 (BGK55_05695) | pilR | 1266544..1267998 (-) | 1455 | WP_033481907.1 | sigma-54 dependent transcriptional regulator | Regulator |
| BGK55_RS05705 (BGK55_05700) | - | 1268263..1269876 (-) | 1614 | WP_005915814.1 | HAMP domain-containing sensor histidine kinase | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=194549 BGK55_RS05695 WP_005915819.1 1265939..1266058(+) (pilB) [Xanthomonas citri pv. malvacearum strain MSCT]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=194549 BGK55_RS05695 WP_005915819.1 1265939..1266058(+) (pilB) [Xanthomonas citri pv. malvacearum strain MSCT]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |