Detailed information NTG0126059

Bioinformatically predicted

Overview

• Name: pilB
• Type: Machinery gene
• Locus tag: AMD10_RS16875
• Genome accession: NZ_CP009007
• Coordinates: 3816627..3816746 (-)
• Length: 39 a.a.
• NCBI ID: WP_005915819.1
• Uniprot ID: A0A7S6YV99
• Organism: Xanthomonas citri pv. citri strain MF20
• Function: power the assembly of type IV pilus (predicted from homology) DNA binding and uptake

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type	MGE coordinates	Gene coordinates	Relative position	Distance (bp)
Genomic island	3795899..3821657	3816627..3816746	within	0

Gene organization within MGE regions

Location: 3795899..3821657

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
AMD10_RS23980 (J172_03398)	-	3795899..3797066 (+)	1168	Protein_3219	IS3 family transposase	-
AMD10_RS16795 (J172_03400)	avrXacE2	3797826..3798896 (-)	1071	WP_011052114.1	type III secretion system effector avirulence protein AvrXacE2	-
AMD10_RS16800 (J172_03401)	-	3798981..3800258 (-)	1278	WP_011052115.1	lytic murein transglycosylase	-
AMD10_RS16805 (J172_03402)	-	3800391..3803381 (-)	2991	WP_040107658.1	Tn3-like element TnXax1 family transposase	-
AMD10_RS16810 (J172_03403)	-	3803390..3804664 (-)	1275	Protein_3223	site-specific integrase	-
AMD10_RS16820 (J172_03405)	-	3804857..3805933 (+)	1077	WP_011052118.1	DNA-binding protein	-
AMD10_RS16825 (J172_03406)	xopAI	3806067..3806957 (+)	891	WP_011052119.1	type III secretion system effector XopAI	-
AMD10_RS16830 (J172_03407)	-	3807377..3808183 (-)	807	WP_015463520.1	hypothetical protein	-
AMD10_RS16835 (J172_03408)	-	3808288..3808572 (+)	285	WP_016849322.1	hypothetical protein	-
AMD10_RS16840 (J172_03409)	-	3808800..3809915 (+)	1116	WP_011052122.1	IS1595 family transposase	-
AMD10_RS16845 (J172_03410)	-	3809870..3810385 (-)	516	WP_011052123.1	hypothetical protein	-
AMD10_RS16850 (J172_03411)	sucD	3810472..3811347 (-)	876	WP_005921370.1	succinate--CoA ligase subunit alpha	-
AMD10_RS16855 (J172_03412)	sucC	3811372..3812541 (-)	1170	WP_005915812.1	ADP-forming succinate--CoA ligase subunit beta	-
AMD10_RS16860 (J172_03413)	-	3812773..3814386 (+)	1614	WP_003488599.1	HAMP domain-containing sensor histidine kinase	-
AMD10_RS16865 (J172_03414)	pilR	3814711..3816105 (+)	1395	WP_015463522.1	sigma-54 dependent transcriptional regulator	Regulator
AMD10_RS16870 (J172_03416)	-	3816328..3816495 (-)	168	WP_015463523.1	hypothetical protein	-
AMD10_RS16875 (J172_03417)	pilB	3816627..3816746 (-)	120	WP_005915819.1	hypothetical protein	Machinery gene
AMD10_RS16880 (J172_03418)	pilB	3817240..3818976 (-)	1737	WP_011052125.1	type IV-A pilus assembly ATPase PilB	Machinery gene
AMD10_RS16885 (J172_03419)	-	3819040..3819495 (-)	456	WP_015463526.1	pilin	-
AMD10_RS16890 (J172_03420)	-	3819605..3820045 (-)	441	WP_011052127.1	pilin	-
AMD10_RS16895 (J172_03421)	pilC	3820401..3821657 (+)	1257	WP_040107659.1	type II secretion system F family protein	Machinery gene

Sequence

Protein

• Length: 39 a.a.
• Molecular weight: 4178.84 Da
• Isoelectric Point: 9.0113

>NTDB_id=126059 AMD10_RS16875 WP_005915819.1 3816627..3816746(-) (pilB) [Xanthomonas citri pv. citri strain MF20]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD

Nucleotide

• Length: 120 bp

>NTDB_id=126059 AMD10_RS16875 WP_005915819.1 3816627..3816746(-) (pilB) [Xanthomonas citri pv. citri strain MF20]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA

Domains

No domain identified.

3D structure

• AlphaFold DB: A0A7S6YV99

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
pilB	Acinetobacter baylyi ADP1	51.282	100	0.513
pilB	Acinetobacter baumannii D1279779	48.718	100	0.487
pilB	Vibrio cholerae strain A1552	45.714	89.744	0.41
pilB	Legionella pneumophila strain ERS1305867	38.462	100	0.385