Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | AMD15_RS16800 | Genome accession | NZ_CP009001 |
| Coordinates | 3791925..3792044 (-) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri pv. citri strain MN11 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 3786925..3797044
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| AMD15_RS16785 (J163_03398) | - | 3788071..3789684 (+) | 1614 | WP_003488599.1 | HAMP domain-containing sensor histidine kinase | - |
| AMD15_RS16790 (J163_03399) | pilR | 3790009..3791403 (+) | 1395 | WP_015463522.1 | sigma-54 dependent transcriptional regulator | Regulator |
| AMD15_RS16795 (J163_03401) | - | 3791626..3791793 (-) | 168 | WP_015463523.1 | hypothetical protein | - |
| AMD15_RS16800 (J163_03402) | pilB | 3791925..3792044 (-) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
| AMD15_RS16805 (J163_03403) | pilB | 3792538..3794274 (-) | 1737 | WP_011052125.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| AMD15_RS16810 (J163_03404) | - | 3794338..3794793 (-) | 456 | WP_015463526.1 | pilin | - |
| AMD15_RS16815 (J163_03405) | - | 3794903..3795343 (-) | 441 | WP_011052127.1 | pilin | - |
| AMD15_RS16820 (J163_03406) | pilC | 3795699..3796955 (+) | 1257 | WP_040107659.1 | type II secretion system F family protein | Machinery gene |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=126026 AMD15_RS16800 WP_005915819.1 3791925..3792044(-) (pilB) [Xanthomonas citri pv. citri strain MN11]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=126026 AMD15_RS16800 WP_005915819.1 3791925..3792044(-) (pilB) [Xanthomonas citri pv. citri strain MN11]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |