Detailed information    

insolico Bioinformatically predicted

Overview

Name   comC/blpC   Type   Regulator
Locus tag   ACF1RT_RS01455 Genome accession   NZ_CP172847
Coordinates   290820..290960 (-) Length   46 a.a.
NCBI ID   WP_002267610.1    Uniprot ID   Q99QI5
Organism   Streptococcus mutans strain DPC6143     
Function   binding to ComD; induce autophosphorylation of ComD; regulation of comX expression (predicted from homology)   
Competence regulation

Genomic Context

Location: 285820..295960
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACF1RT_RS01435 (ACF1RT_01435) - 286822..287448 (+) 627 WP_002268642.1 hypothetical protein -
  ACF1RT_RS01440 (ACF1RT_01440) - 287496..288134 (+) 639 WP_002271525.1 VTT domain-containing protein -
  ACF1RT_RS01445 (ACF1RT_01445) comE/blpR 288605..289360 (+) 756 WP_226711110.1 response regulator transcription factor Regulator
  ACF1RT_RS01450 (ACF1RT_01450) comD/blpH 289353..290678 (+) 1326 WP_400260324.1 sensor histidine kinase Regulator
  ACF1RT_RS01455 (ACF1RT_01455) comC/blpC 290820..290960 (-) 141 WP_002267610.1 ComC/BlpC family leader-containing pheromone/bacteriocin Regulator
  ACF1RT_RS01460 (ACF1RT_01460) cipB 291227..291457 (+) 231 WP_002265368.1 Blp family class II bacteriocin Regulator
  ACF1RT_RS01465 (ACF1RT_01465) - 291588..291989 (+) 402 WP_002310604.1 hypothetical protein -
  ACF1RT_RS01470 (ACF1RT_01470) - 293370..293789 (+) 420 WP_002263913.1 hypothetical protein -
  ACF1RT_RS01475 (ACF1RT_01475) - 293936..294340 (+) 405 WP_002263912.1 hypothetical protein -
  ACF1RT_RS01480 (ACF1RT_01480) - 294463..294675 (-) 213 Protein_267 IS3 family transposase -
  ACF1RT_RS01485 (ACF1RT_01485) - 295115..295279 (+) 165 WP_002265308.1 hypothetical protein -
  ACF1RT_RS01490 (ACF1RT_01490) - 295663..295875 (+) 213 WP_002263744.1 Blp family class II bacteriocin -

Sequence

Protein


Download         Length: 46 a.a.        Molecular weight: 5211.06 Da        Isoelectric Point: 10.4929

>NTDB_id=1069069 ACF1RT_RS01455 WP_002267610.1 290820..290960(-) (comC/blpC) [Streptococcus mutans strain DPC6143]
MKKTLSLKNDFKEIKTDELEIIIGGSGSLSTFFRLFNRSFTQALGK

Nucleotide


Download         Length: 141 bp        

>NTDB_id=1069069 ACF1RT_RS01455 WP_002267610.1 290820..290960(-) (comC/blpC) [Streptococcus mutans strain DPC6143]
ATGAAAAAAACACTATCATTAAAAAATGACTTTAAAGAAATTAAGACTGATGAATTAGAGATTATCATTGGCGGAAGCGG
AAGCCTATCAACATTTTTCCGGCTGTTTAACAGAAGTTTTACACAAGCTTTGGGAAAATAA

Domains

Predicted by InterproScan.

COMC family (ComC)

(1-32)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  PDB 2I2J

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comC/blpC Streptococcus mutans UA159

100

100

1

Multiple sequence alignment