Detailed information
Bioinformatically predicted
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | ACCP91_RS05640 | Genome accession | NZ_CP167209 |
| Coordinates | 1236693..1236812 (+) | Length | 39 a.a. |
| NCBI ID | WP_029220459.1 | Uniprot ID | A0A7Z2ZHL3 |
| Organism | Xanthomonas axonopodis pv. cyamopsidis strain NCPPB 637 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 1231693..1241812
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ACCP91_RS05615 (ACCP91_05615) | - | 1231897..1232247 (+) | 351 | WP_372162904.1 | SMR family transporter | - |
| ACCP91_RS05620 (ACCP91_05620) | - | 1232252..1233046 (+) | 795 | WP_277573650.1 | glycosyltransferase | - |
| ACCP91_RS05625 (ACCP91_05625) | - | 1233061..1234089 (+) | 1029 | WP_372162906.1 | glycosyltransferase | - |
| ACCP91_RS05630 (ACCP91_05630) | - | 1234082..1234729 (+) | 648 | WP_277573648.1 | methionine biosynthesis protein MetW | - |
| ACCP91_RS05635 (ACCP91_05635) | pilB | 1234826..1236562 (+) | 1737 | WP_372163326.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| ACCP91_RS05640 (ACCP91_05640) | pilB | 1236693..1236812 (+) | 120 | WP_029220459.1 | hypothetical protein | Machinery gene |
| ACCP91_RS05645 (ACCP91_05645) | pilR | 1237021..1238475 (-) | 1455 | WP_206212849.1 | sigma-54 dependent transcriptional regulator | Regulator |
| ACCP91_RS05650 (ACCP91_05650) | - | 1238742..1240355 (-) | 1614 | WP_372162909.1 | ATP-binding protein | - |
| ACCP91_RS05655 (ACCP91_05655) | sucC | 1240587..1241756 (+) | 1170 | WP_007965356.1 | ADP-forming succinate--CoA ligase subunit beta | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4235.93 Da Isoelectric Point: 10.4810
>NTDB_id=1038867 ACCP91_RS05640 WP_029220459.1 1236693..1236812(+) (pilB) [Xanthomonas axonopodis pv. cyamopsidis strain NCPPB 637]
MQIAEAAQKIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQKIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=1038867 ACCP91_RS05640 WP_029220459.1 1236693..1236812(+) (pilB) [Xanthomonas axonopodis pv. cyamopsidis strain NCPPB 637]
ATGCAGATCGCCGAGGCGGCGCAGAAGATCGGTATTCGCGATTTGCGCCAGTCGGCGTTGATGAAGGCTGCGCATGGGGT
GACCAGCCTGGCGGAAATCAATCGGGTGACGAAGGACTGA
ATGCAGATCGCCGAGGCGGCGCAGAAGATCGGTATTCGCGATTTGCGCCAGTCGGCGTTGATGAAGGCTGCGCATGGGGT
GACCAGCCTGGCGGAAATCAATCGGGTGACGAAGGACTGA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baumannii D1279779 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |
| pilF | Neisseria gonorrhoeae MS11 |
40.541 |
94.872 |
0.385 |
| pilB | Vibrio cholerae strain A1552 |
42.857 |
89.744 |
0.385 |