Detailed information
Bioinformatically predicted
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | ABLG39_RS06040 | Genome accession | NZ_CP157595 |
| Coordinates | 1265947..1266066 (+) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri pv. malvacearum strain Xcm TX4-attenuated | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 1260947..1271066
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ABLG39_RS06015 (ABLG39_06020) | - | 1261241..1261525 (+) | 285 | WP_232515052.1 | SMR family transporter | - |
| ABLG39_RS06020 (ABLG39_06025) | - | 1261530..1262324 (+) | 795 | WP_005915828.1 | glycosyltransferase | - |
| ABLG39_RS06025 (ABLG39_06030) | - | 1262339..1263367 (+) | 1029 | WP_234787234.1 | glycosyltransferase | - |
| ABLG39_RS06030 (ABLG39_06035) | - | 1263360..1264016 (+) | 657 | WP_157733690.1 | methionine biosynthesis protein MetW | - |
| ABLG39_RS06035 (ABLG39_06040) | pilB | 1264114..1265850 (+) | 1737 | WP_005915821.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| ABLG39_RS06040 (ABLG39_06045) | pilB | 1265947..1266066 (+) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
| ABLG39_RS06045 (ABLG39_06050) | - | 1266222..1266365 (+) | 144 | WP_005915817.1 | hypothetical protein | - |
| ABLG39_RS06050 (ABLG39_06055) | pilR | 1266552..1268006 (-) | 1455 | WP_033481907.1 | sigma-54 dependent transcriptional regulator | Regulator |
| ABLG39_RS06055 (ABLG39_06060) | - | 1268271..1269884 (-) | 1614 | WP_005915814.1 | HAMP domain-containing sensor histidine kinase | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=1007581 ABLG39_RS06040 WP_005915819.1 1265947..1266066(+) (pilB) [Xanthomonas citri pv. malvacearum strain Xcm TX4-attenuated]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=1007581 ABLG39_RS06040 WP_005915819.1 1265947..1266066(+) (pilB) [Xanthomonas citri pv. malvacearum strain Xcm TX4-attenuated]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |