Detailed information of TA system
Overview
TA module
Type | I | Classification (family/domain) | yonT-SR6/- |
Location | 2192282..2192611 | Replicon | chromosome |
Accession | NZ_CP008698 | ||
Organism | Bacillus subtilis subsp. subtilis str. AG1839 |
Toxin (Protein)
Gene name | yonT | Uniprot ID | C0H439 |
Locus tag | BSUB_RS22380 | Protein ID | WP_010886546.1 |
Coordinates | 2192282..2192533 (-) | Length | 84 a.a. |
Antitoxin (RNA)
Gene name | SR6 | ||
Locus tag | - | ||
Coordinates | 2192511..2192611 (+) |
Genomic Context
Location: 2192511..2192611 (101 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 2192669..2192769 (101 bp)
Type: Others
Protein ID: NuclAT_2
Type: Others
Protein ID: NuclAT_2
Location: 2192669..2192769 (101 bp)
Type: Others
Protein ID: NuclAT_2
Type: Others
Protein ID: NuclAT_2
Location: 2192669..2192769 (101 bp)
Type: Others
Protein ID: NuclAT_2
Type: Others
Protein ID: NuclAT_2
Location: 2192669..2192769 (101 bp)
Type: Others
Protein ID: NuclAT_2
Type: Others
Protein ID: NuclAT_2
Location: 2195108..2195302 (195 bp)
Type: Others
Protein ID: WP_004399291.1
Type: Others
Protein ID: WP_004399291.1
Location: 2187740..2187967 (228 bp)
Type: Others
Protein ID: WP_004399298.1
Type: Others
Protein ID: WP_004399298.1
Location: 2188228..2189544 (1317 bp)
Type: Others
Protein ID: WP_004399369.1
Type: Others
Protein ID: WP_004399369.1
Location: 2189901..2190407 (507 bp)
Type: Others
Protein ID: WP_004399486.1
Type: Others
Protein ID: WP_004399486.1
Location: 2190735..2191967 (1233 bp)
Type: Others
Protein ID: WP_004399445.1
Type: Others
Protein ID: WP_004399445.1
Location: 2192049..2192237 (189 bp)
Type: Others
Protein ID: WP_004399547.1
Type: Others
Protein ID: WP_004399547.1
Location: 2192282..2192533 (252 bp)
Type: Toxin
Protein ID: WP_010886546.1
Type: Toxin
Protein ID: WP_010886546.1
Location: 2192552..2192728 (177 bp)
Type: Others
Protein ID: WP_009967515.1
Type: Others
Protein ID: WP_009967515.1
Location: 2193103..2193714 (612 bp)
Type: Others
Protein ID: WP_009967516.1
Type: Others
Protein ID: WP_009967516.1
Location: 2193829..2194155 (327 bp)
Type: Others
Protein ID: WP_009967517.1
Type: Others
Protein ID: WP_009967517.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
BSUB_RS11440 | 2187740..2187967 | - | 228 | WP_004399298.1 | helix-turn-helix transcriptional regulator | - |
BSUB_RS11445 | 2188228..2189544 | - | 1317 | WP_004399369.1 | hypothetical protein | - |
BSUB_RS11450 | 2189901..2190407 | - | 507 | WP_004399486.1 | hypothetical protein | - |
BSUB_RS11455 | 2190735..2191967 | - | 1233 | WP_004399445.1 | hypothetical protein | - |
BSUB_RS11460 | 2192049..2192237 | - | 189 | WP_004399547.1 | hypothetical protein | - |
BSUB_RS22380 | 2192282..2192533 | - | 252 | WP_010886546.1 | hypothetical protein | Toxin |
- | 2192511..2192611 | + | 101 | - | - | Antitoxin |
BSUB_RS11465 | 2192552..2192728 | - | 177 | WP_009967515.1 | hypothetical protein | - |
- | 2192669..2192769 | + | 101 | NuclAT_2 | - | - |
- | 2192669..2192769 | + | 101 | NuclAT_2 | - | - |
- | 2192669..2192769 | + | 101 | NuclAT_2 | - | - |
- | 2192669..2192769 | + | 101 | NuclAT_2 | - | - |
BSUB_RS11470 | 2193103..2193714 | - | 612 | WP_009967516.1 | lipoprotein | - |
BSUB_RS11475 | 2193829..2194155 | - | 327 | WP_009967517.1 | helix-turn-helix domain-containing protein | - |
BSUB_RS11480 | 2195108..2195302 | + | 195 | WP_004399291.1 | hypothetical protein | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
inside | Prophage | - | - | 2124394..2259176 | 134782 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 84 a.a. Molecular weight: 9956.96 Da Isoelectric Point: 9.7930
>T47257 WP_010886546.1 NZ_CP008698:c2192533-2192282 [Bacillus subtilis subsp. subtilis str. AG1839]
MNFSFSSYPYYNMIKHIANMKRFSLWFTHITFIGLFLMFQLIKDYFSSEGQALINTIFVVTCIIAILLWIIYCVFLKLRN
KSH
MNFSFSSYPYYNMIKHIANMKRFSLWFTHITFIGLFLMFQLIKDYFSSEGQALINTIFVVTCIIAILLWIIYCVFLKLRN
KSH
Download Length: 252 bp
>T47257 NZ_CP008698:c2192533-2192282 [Bacillus subtilis subsp. subtilis str. AG1839]
ATGAACTTCTCCTTTAGTTCCTACCCATATTATAACATGATCAAGCACATTGCAAACATGAAACGATTCTCATTATGGTT
TACCCATATCACATTCATTGGCTTATTCTTAATGTTTCAACTCATCAAAGATTACTTCAGCAGCGAAGGACAGGCGCTAA
TCAACACAATTTTTGTTGTCACATGTATCATTGCCATATTGTTATGGATCATCTATTGTGTATTCCTTAAACTAAGAAAC
AAGTCACACTAA
ATGAACTTCTCCTTTAGTTCCTACCCATATTATAACATGATCAAGCACATTGCAAACATGAAACGATTCTCATTATGGTT
TACCCATATCACATTCATTGGCTTATTCTTAATGTTTCAACTCATCAAAGATTACTTCAGCAGCGAAGGACAGGCGCTAA
TCAACACAATTTTTGTTGTCACATGTATCATTGCCATATTGTTATGGATCATCTATTGTGTATTCCTTAAACTAAGAAAC
AAGTCACACTAA
Antitoxin
Download Length: 101 bp
>AT47257 NZ_CP008698:2192511-2192611 [Bacillus subtilis subsp. subtilis str. AG1839]
TAGGAACTAAAGGAGAAGTTCATTCCCCTTTAGCTTAGCTCTCATCGGCGTATACGTTGGCGTTGTCTCTTTGGTCGGAG
CCGCTTGCGTATACGCTTTTT
TAGGAACTAAAGGAGAAGTTCATTCCCCTTTAGCTTAGCTCTCATCGGCGTATACGTTGGCGTTGTCTCTTTGGTCGGAG
CCGCTTGCGTATACGCTTTTT
Structures
Toxin
Loading, please wait
Source | ID | Structure |
---|---|---|
AlphaFold DB | C0H439 |
Antitoxin
Download structure file