Detailed information of TA system TA296850

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): yonT-as-bsrG/-
• Location: 2264835..2265322
• Replicon: chromosome
• Accession: NZ_OX419569
• Organism: Bacillus subtilis isolate NRS6118

Toxin (Protein)

• Gene name: yonT
• Uniprot ID: C0H439
• Locus tag: KJP55_RS11710
• Protein ID: WP_010886546.1
• Coordinates: 2264835..2265086 (-)
• Length: 84 a.a.

Antitoxin (RNA)

Gene name	as-bsrG
Locus tag	-
Coordinates	2265222..2265322 (+)

Genomic Context

Location: 2265222..2265322 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 2265222..2265322 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 2265222..2265322 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 2265222..2265322 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 2267661..2267855 (195 bp)
Type: Others
Protein ID: WP_004399291.1

Location: 2260293..2260520 (228 bp)
Type: Others
Protein ID: WP_004399298.1

Location: 2260781..2262097 (1317 bp)
Type: Others
Protein ID: WP_004399369.1

Location: 2262454..2262960 (507 bp)
Type: Others
Protein ID: WP_004399486.1

Location: 2263288..2264520 (1233 bp)
Type: Others
Protein ID: WP_004399445.1

Location: 2264602..2264790 (189 bp)
Type: Others
Protein ID: WP_004399547.1

Location: 2264835..2265086 (252 bp)
Type: Toxin
Protein ID: WP_010886546.1

Location: 2265105..2265281 (177 bp)
Type: Others
Protein ID: WP_009967515.1

Location: 2265656..2266267 (612 bp)
Type: Others
Protein ID: WP_009967516.1

Location: 2266382..2266708 (327 bp)
Type: Others
Protein ID: WP_009967517.1

Loading, please wait

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
KJP55_RS11685 (2260293)	2260293..2260520	-	228	WP_004399298.1	helix-turn-helix transcriptional regulator	-
KJP55_RS11690 (2260781)	2260781..2262097	-	1317	WP_004399369.1	hypothetical protein	-
KJP55_RS11695 (2262454)	2262454..2262960	-	507	WP_004399486.1	hypothetical protein	-
KJP55_RS11700 (2263288)	2263288..2264520	-	1233	WP_004399445.1	hypothetical protein	-
KJP55_RS11705 (2264602)	2264602..2264790	-	189	WP_004399547.1	hypothetical protein	-
KJP55_RS11710 (2264835)	2264835..2265086	-	252	WP_010886546.1	hypothetical protein	Toxin
KJP55_RS11715 (2265105)	2265105..2265281	-	177	WP_009967515.1	hypothetical protein	-
- (2265222)	2265222..2265322	+	101	NuclAT_2	-	Antitoxin
- (2265222)	2265222..2265322	+	101	NuclAT_2	-	Antitoxin
- (2265222)	2265222..2265322	+	101	NuclAT_2	-	Antitoxin
- (2265222)	2265222..2265322	+	101	NuclAT_2	-	Antitoxin
KJP55_RS11720 (2265656)	2265656..2266267	-	612	WP_009967516.1	lipoprotein	-
KJP55_RS11725 (2266382)	2266382..2266708	-	327	WP_009967517.1	helix-turn-helix transcriptional regulator	-
KJP55_RS11730 (2267661)	2267661..2267855	+	195	WP_004399291.1	hypothetical protein	-

Associated MGEs

Loading, please wait

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	Similar MGE(s) Similar MGE(s) is defined as other TA-related MGE(s) with Mash distance < 0.01 to this MGE. Detail Genome accession Organism MGE type Related TA Coordinates Mash distance View NC_000964 Bacillus subtilis subsp. subtilis str. 168 Prophage TA006323, TA006321, TA06323b, TA020252 2151626..2286408 0.003	inside	Prophage	-	-	2195159..2345976	150817

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

No domain identified.

Sequences

Toxin

Protein

• Length: 84 a.a.
• Molecular weight: 9956.96 Da
• Isoelectric Point: 9.7930

>T296850 WP_010886546.1 NZ_OX419569:c2265086-2264835 [Bacillus subtilis]
MNFSFSSYPYYNMIKHIANMKRFSLWFTHITFIGLFLMFQLIKDYFSSEGQALINTIFVVTCIIAILLWIIYCVFLKLRN
KSH

Nucleotide

• Length: 252 bp

Antitoxin

Nucleotide

• Length: 101 bp

>AT296850 NZ_OX419569:2265222-2265322 [Bacillus subtilis]
GATTGTAAGAACCGTTAAAGATATGAGGAAAGCAACTACGATACCCATTTTCTCAAGCACTATGTACACCTCCTTTCCTA
TGACTCTATTATAACATAATT

Similar Proteins

Only experimentally validated proteins are listed.

Toxin

Loading, please wait

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
No matching records found

Showing 1 to 0 of 0 rows

10

rows per page

• ‹
• ›

Antitoxin

Loading, please wait

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
No matching records found

Showing 1 to 0 of 0 rows

10

rows per page

• ‹
• ›

Structures

Toxin

Loading, please wait

• AlphaFold DB: C0H439

Antitoxin