Detailed information of TA system TA282364

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): yonT-as-bsrG/-
• Location: 2078437..2078924
• Replicon: chromosome
• Accession: NZ_CP125762
• Organism: Bacillus subtilis strain KRS015

Toxin (Protein)

• Gene name: yonT
• Uniprot ID: C0H439
• Locus tag: QLQ05_RS11205
• Protein ID: WP_010886546.1
• Coordinates: 2078673..2078924 (+)
• Length: 84 a.a.

Antitoxin (RNA)

Gene name	as-bsrG
Locus tag	-
Coordinates	2078437..2078537 (-)

Genomic Context

Location: 2077051..2077377 (327 bp)
Type: Others
Protein ID: WP_009967517.1

Location: 2077492..2078103 (612 bp)
Type: Others
Protein ID: WP_009967516.1

Location: 2078478..2078654 (177 bp)
Type: Others
Protein ID: WP_009967515.1

Location: 2078673..2078924 (252 bp)
Type: Toxin
Protein ID: WP_010886546.1

Location: 2078969..2079157 (189 bp)
Type: Others
Protein ID: WP_004399547.1

Location: 2079239..2080471 (1233 bp)
Type: Others
Protein ID: WP_004399445.1

Location: 2080799..2081305 (507 bp)
Type: Others
Protein ID: WP_004399486.1

Location: 2081662..2082978 (1317 bp)
Type: Others
Protein ID: WP_004399369.1

Location: 2083239..2083466 (228 bp)
Type: Others
Protein ID: WP_004399298.1

Location: 2075904..2076098 (195 bp)
Type: Others
Protein ID: WP_004399291.1

Location: 2078437..2078537 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_5

Location: 2078437..2078537 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_5

Location: 2078437..2078537 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_5

Location: 2078437..2078537 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_5

Loading, please wait

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
QLQ05_RS11185 (2075904)	2075904..2076098	-	195	WP_004399291.1	hypothetical protein	-
QLQ05_RS11190 (2077051)	2077051..2077377	+	327	WP_009967517.1	helix-turn-helix transcriptional regulator	-
QLQ05_RS11195 (2077492)	2077492..2078103	+	612	WP_009967516.1	lipoprotein	-
- (2078437)	2078437..2078537	-	101	NuclAT_5	-	Antitoxin
- (2078437)	2078437..2078537	-	101	NuclAT_5	-	Antitoxin
- (2078437)	2078437..2078537	-	101	NuclAT_5	-	Antitoxin
- (2078437)	2078437..2078537	-	101	NuclAT_5	-	Antitoxin
QLQ05_RS11200 (2078478)	2078478..2078654	+	177	WP_009967515.1	hypothetical protein	-
QLQ05_RS11205 (2078673)	2078673..2078924	+	252	WP_010886546.1	hypothetical protein	Toxin
QLQ05_RS11210 (2078969)	2078969..2079157	+	189	WP_004399547.1	hypothetical protein	-
QLQ05_RS11215 (2079239)	2079239..2080471	+	1233	WP_004399445.1	hypothetical protein	-
QLQ05_RS11220 (2080799)	2080799..2081305	+	507	WP_004399486.1	hypothetical protein	-
QLQ05_RS11225 (2081662)	2081662..2082978	+	1317	WP_004399369.1	hypothetical protein	-
QLQ05_RS11230 (2083239)	2083239..2083466	+	228	WP_004399298.1	helix-turn-helix transcriptional regulator	-

Associated MGEs

Loading, please wait

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	Similar MGE(s) Similar MGE(s) is defined as other TA-related MGE(s) with Mash distance < 0.01 to this MGE. Detail Genome accession Organism MGE type Related TA Coordinates Mash distance View NC_000964 Bacillus subtilis subsp. subtilis str. 168 Prophage TA006323, TA006321, TA06323b, TA020252 2151626..2286408 0	inside	Prophage	-	-	2012030..2280951	268921

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

No domain identified.

Sequences

Toxin

Protein

• Length: 84 a.a.
• Molecular weight: 9956.96 Da
• Isoelectric Point: 9.7930

>T282364 WP_010886546.1 NZ_CP125762:2078673-2078924 [Bacillus subtilis]
MNFSFSSYPYYNMIKHIANMKRFSLWFTHITFIGLFLMFQLIKDYFSSEGQALINTIFVVTCIIAILLWIIYCVFLKLRN
KSH

Nucleotide

• Length: 252 bp

Antitoxin

Nucleotide

• Length: 101 bp

>AT282364 NZ_CP125762:c2078537-2078437 [Bacillus subtilis]
GATTGTAAGAACCGTTAAAGATATGAGGAAAGCAACTACGATACCCATTTTCTCAAGCACTATGTACACCTCCTTTCCTA
TGACTCTATTATAACATAATT

Similar Proteins

Only experimentally validated proteins are listed.

Toxin

Loading, please wait

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
No matching records found

Showing 1 to 0 of 0 rows

10

rows per page

• ‹
• ›

Antitoxin

Loading, please wait

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
No matching records found

Showing 1 to 0 of 0 rows

10

rows per page

• ‹
• ›

Structures

Toxin

Loading, please wait

• AlphaFold DB: C0H439

Antitoxin