Detailed information of TA system TA275354

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): yonT-as-bsrG/-
• Location: 1584244..1584731
• Replicon: chromosome
• Accession: NZ_CP120681
• Organism: Bacillus subtilis strain DSM 10

Toxin (Protein)

• Gene name: yonT
• Uniprot ID: C0H439
• Locus tag: P5655_RS08585
• Protein ID: WP_010886546.1
• Coordinates: 1584244..1584495 (-)
• Length: 84 a.a.

Antitoxin (RNA)

Gene name	as-bsrG
Locus tag	-
Coordinates	1584631..1584731 (+)

Genomic Context

Location: 1584631..1584731 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 1584631..1584731 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 1584631..1584731 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 1584631..1584731 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 1587070..1587264 (195 bp)
Type: Others
Protein ID: WP_004399291.1

Location: 1579701..1579928 (228 bp)
Type: Others
Protein ID: WP_004399298.1

Location: 1580189..1581505 (1317 bp)
Type: Others
Protein ID: WP_004399369.1

Location: 1581862..1582368 (507 bp)
Type: Others
Protein ID: WP_004399486.1

Location: 1582697..1583929 (1233 bp)
Type: Others
Protein ID: WP_004399445.1

Location: 1584011..1584199 (189 bp)
Type: Others
Protein ID: WP_004399547.1

Location: 1584244..1584495 (252 bp)
Type: Toxin
Protein ID: WP_010886546.1

Location: 1584514..1584690 (177 bp)
Type: Others
Protein ID: WP_009967515.1

Location: 1585065..1585676 (612 bp)
Type: Others
Protein ID: WP_009967516.1

Location: 1585791..1586117 (327 bp)
Type: Others
Protein ID: WP_009967517.1

Loading, please wait

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
P5655_RS08560 (1579701)	1579701..1579928	-	228	WP_004399298.1	helix-turn-helix transcriptional regulator	-
P5655_RS08565 (1580189)	1580189..1581505	-	1317	WP_004399369.1	hypothetical protein	-
P5655_RS08570 (1581862)	1581862..1582368	-	507	WP_004399486.1	hypothetical protein	-
P5655_RS08575 (1582697)	1582697..1583929	-	1233	WP_004399445.1	hypothetical protein	-
P5655_RS08580 (1584011)	1584011..1584199	-	189	WP_004399547.1	hypothetical protein	-
P5655_RS08585 (1584244)	1584244..1584495	-	252	WP_010886546.1	hypothetical protein	Toxin
P5655_RS08590 (1584514)	1584514..1584690	-	177	WP_009967515.1	hypothetical protein	-
- (1584631)	1584631..1584731	+	101	NuclAT_2	-	Antitoxin
- (1584631)	1584631..1584731	+	101	NuclAT_2	-	Antitoxin
- (1584631)	1584631..1584731	+	101	NuclAT_2	-	Antitoxin
- (1584631)	1584631..1584731	+	101	NuclAT_2	-	Antitoxin
P5655_RS08595 (1585065)	1585065..1585676	-	612	WP_009967516.1	lipoprotein	-
P5655_RS08600 (1585791)	1585791..1586117	-	327	WP_009967517.1	helix-turn-helix transcriptional regulator	-
P5655_RS08605 (1587070)	1587070..1587264	+	195	WP_004399291.1	hypothetical protein	-

Associated MGEs

Loading, please wait

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	Similar MGE(s) Similar MGE(s) is defined as other TA-related MGE(s) with Mash distance < 0.01 to this MGE. Detail Genome accession Organism MGE type Related TA Coordinates Mash distance View NC_000964 Bacillus subtilis subsp. subtilis str. 168 Prophage TA006323, TA006321, TA06323b, TA020252 2151626..2286408 0.003	inside	Prophage	-	-	1516355..1665384	149029

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

No domain identified.

Sequences

Toxin

Protein

• Length: 84 a.a.
• Molecular weight: 9956.96 Da
• Isoelectric Point: 9.7930

>T275354 WP_010886546.1 NZ_CP120681:c1584495-1584244 [Bacillus subtilis]
MNFSFSSYPYYNMIKHIANMKRFSLWFTHITFIGLFLMFQLIKDYFSSEGQALINTIFVVTCIIAILLWIIYCVFLKLRN
KSH

Nucleotide

• Length: 252 bp

Antitoxin

Nucleotide

• Length: 101 bp

>AT275354 NZ_CP120681:1584631-1584731 [Bacillus subtilis]
GATTGTAAGAACCGTTAAAGATATGAGGAAAGCAACTACGATACCCATTTTCTCAAGCACTATGTACACCTCCTTTCCTA
TGACTCTATTATAACATAATT

Similar Proteins

Only experimentally validated proteins are listed.

Toxin

Loading, please wait

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
No matching records found

Showing 1 to 0 of 0 rows

10

rows per page

• ‹
• ›

Antitoxin

Loading, please wait

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
No matching records found

Showing 1 to 0 of 0 rows

10

rows per page

• ‹
• ›

Structures

Toxin

Loading, please wait

• AlphaFold DB: C0H439

Antitoxin