Detailed information of TA system TA275263

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): yonT-as-bsrG/-
• Location: 2936299..2936786
• Replicon: chromosome
• Accession: NZ_CP120613
• Organism: Bacillus subtilis strain DSM 23521

Toxin (Protein)

• Gene name: yonT
• Uniprot ID: C0H439
• Locus tag: P5649_RS15515
• Protein ID: WP_010886546.1
• Coordinates: 2936535..2936786 (+)
• Length: 84 a.a.

Antitoxin (RNA)

Gene name	as-bsrG
Locus tag	-
Coordinates	2936299..2936399 (-)

Genomic Context

Location: 2934913..2935239 (327 bp)
Type: Others
Protein ID: WP_009967517.1

Location: 2935354..2935965 (612 bp)
Type: Others
Protein ID: WP_009967516.1

Location: 2936340..2936516 (177 bp)
Type: Others
Protein ID: WP_009967515.1

Location: 2936535..2936786 (252 bp)
Type: Toxin
Protein ID: WP_010886546.1

Location: 2936831..2937019 (189 bp)
Type: Others
Protein ID: WP_004399547.1

Location: 2937101..2938333 (1233 bp)
Type: Others
Protein ID: WP_004399445.1

Location: 2938661..2939167 (507 bp)
Type: Others
Protein ID: WP_004399486.1

Location: 2939524..2940840 (1317 bp)
Type: Others
Protein ID: WP_004399369.1

Location: 2941101..2941328 (228 bp)
Type: Others
Protein ID: WP_004399298.1

Location: 2933767..2933961 (195 bp)
Type: Others
Protein ID: WP_004399291.1

Location: 2936299..2936399 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 2936299..2936399 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 2936299..2936399 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 2936299..2936399 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Loading, please wait

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
P5649_RS15495 (2933767)	2933767..2933961	-	195	WP_004399291.1	hypothetical protein	-
P5649_RS15500 (2934913)	2934913..2935239	+	327	WP_009967517.1	helix-turn-helix transcriptional regulator	-
P5649_RS15505 (2935354)	2935354..2935965	+	612	WP_009967516.1	lipoprotein	-
- (2936299)	2936299..2936399	-	101	NuclAT_2	-	Antitoxin
- (2936299)	2936299..2936399	-	101	NuclAT_2	-	Antitoxin
- (2936299)	2936299..2936399	-	101	NuclAT_2	-	Antitoxin
- (2936299)	2936299..2936399	-	101	NuclAT_2	-	Antitoxin
P5649_RS15510 (2936340)	2936340..2936516	+	177	WP_009967515.1	hypothetical protein	-
P5649_RS15515 (2936535)	2936535..2936786	+	252	WP_010886546.1	hypothetical protein	Toxin
P5649_RS15520 (2936831)	2936831..2937019	+	189	WP_004399547.1	hypothetical protein	-
P5649_RS15525 (2937101)	2937101..2938333	+	1233	WP_004399445.1	hypothetical protein	-
P5649_RS15530 (2938661)	2938661..2939167	+	507	WP_004399486.1	hypothetical protein	-
P5649_RS15535 (2939524)	2939524..2940840	+	1317	WP_004399369.1	hypothetical protein	-
P5649_RS15540 (2941101)	2941101..2941328	+	228	WP_004399298.1	helix-turn-helix transcriptional regulator	-

Associated MGEs

Loading, please wait

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	Similar MGE(s) Similar MGE(s) is defined as other TA-related MGE(s) with Mash distance < 0.01 to this MGE. Detail Genome accession Organism MGE type Related TA Coordinates Mash distance View NC_000964 Bacillus subtilis subsp. subtilis str. 168 Prophage TA006323, TA006321, TA06323b, TA020252 2151626..2286408 0.003	inside	Prophage	-	-	2855647..3004673	149026

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

No domain identified.

Sequences

Toxin

Protein

• Length: 84 a.a.
• Molecular weight: 9956.96 Da
• Isoelectric Point: 9.7930

>T275263 WP_010886546.1 NZ_CP120613:2936535-2936786 [Bacillus subtilis]
MNFSFSSYPYYNMIKHIANMKRFSLWFTHITFIGLFLMFQLIKDYFSSEGQALINTIFVVTCIIAILLWIIYCVFLKLRN
KSH

Nucleotide

• Length: 252 bp

Antitoxin

Nucleotide

• Length: 101 bp

>AT275263 NZ_CP120613:c2936399-2936299 [Bacillus subtilis]
GATTGTAAGAACCGTTAAAGATATGAGGAAAGCAACTACGATACCCATTTTCTCAAGCACTATGTACACCTCCTTTCCTA
TGACTCTATTATAACATAATT

Similar Proteins

Only experimentally validated proteins are listed.

Toxin

Loading, please wait

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
No matching records found

Showing 1 to 0 of 0 rows

10

rows per page

• ‹
• ›

Antitoxin

Loading, please wait

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
No matching records found

Showing 1 to 0 of 0 rows

10

rows per page

• ‹
• ›

Structures

Toxin

Loading, please wait

• AlphaFold DB: C0H439

Antitoxin