Detailed information of TA system TA256649

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): yonT-as-bsrG/-
• Location: 2218973..2219460
• Replicon: chromosome
• Accession: NZ_CP103783
• Organism: Bacillus subtilis subsp. subtilis str. 168

Toxin (Protein)

• Gene name: yonT
• Uniprot ID: C0H439
• Locus tag: NYR92_RS11445
• Protein ID: WP_010886546.1
• Coordinates: 2218973..2219224 (-)
• Length: 84 a.a.

Antitoxin (RNA)

Gene name	as-bsrG
Locus tag	-
Coordinates	2219360..2219460 (+)

Genomic Context

Location: 2219360..2219460 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 2219360..2219460 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 2219360..2219460 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 2219360..2219460 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 2221799..2221993 (195 bp)
Type: Others
Protein ID: WP_004399291.1

Location: 2214431..2214658 (228 bp)
Type: Others
Protein ID: WP_004399298.1

Location: 2214919..2216235 (1317 bp)
Type: Others
Protein ID: WP_004399369.1

Location: 2216592..2217098 (507 bp)
Type: Others
Protein ID: WP_004399486.1

Location: 2217426..2218658 (1233 bp)
Type: Others
Protein ID: WP_004399445.1

Location: 2218740..2218928 (189 bp)
Type: Others
Protein ID: WP_004399547.1

Location: 2218973..2219224 (252 bp)
Type: Toxin
Protein ID: WP_010886546.1

Location: 2219243..2219419 (177 bp)
Type: Others
Protein ID: WP_009967515.1

Location: 2219794..2220405 (612 bp)
Type: Others
Protein ID: WP_009967516.1

Location: 2220520..2220846 (327 bp)
Type: Others
Protein ID: WP_009967517.1

Loading, please wait

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
NYR92_RS11420 (2214431)	2214431..2214658	-	228	WP_004399298.1	helix-turn-helix transcriptional regulator	-
NYR92_RS11425 (2214919)	2214919..2216235	-	1317	WP_004399369.1	hypothetical protein	-
NYR92_RS11430 (2216592)	2216592..2217098	-	507	WP_004399486.1	hypothetical protein	-
NYR92_RS11435 (2217426)	2217426..2218658	-	1233	WP_004399445.1	hypothetical protein	-
NYR92_RS11440 (2218740)	2218740..2218928	-	189	WP_004399547.1	hypothetical protein	-
NYR92_RS11445 (2218973)	2218973..2219224	-	252	WP_010886546.1	hypothetical protein	Toxin
NYR92_RS11450 (2219243)	2219243..2219419	-	177	WP_009967515.1	hypothetical protein	-
- (2219360)	2219360..2219460	+	101	NuclAT_2	-	Antitoxin
- (2219360)	2219360..2219460	+	101	NuclAT_2	-	Antitoxin
- (2219360)	2219360..2219460	+	101	NuclAT_2	-	Antitoxin
- (2219360)	2219360..2219460	+	101	NuclAT_2	-	Antitoxin
NYR92_RS11455 (2219794)	2219794..2220405	-	612	WP_009967516.1	lipoprotein	-
NYR92_RS11460 (2220520)	2220520..2220846	-	327	WP_009967517.1	helix-turn-helix transcriptional regulator	-
NYR92_RS11465 (2221799)	2221799..2221993	+	195	WP_004399291.1	hypothetical protein	-

Associated MGEs

Loading, please wait

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	Similar MGE(s) Similar MGE(s) is defined as other TA-related MGE(s) with Mash distance < 0.01 to this MGE. Detail Genome accession Organism MGE type Related TA Coordinates Mash distance View NC_000964 Bacillus subtilis subsp. subtilis str. 168 Prophage TA006323, TA006321, TA06323b, TA020252 2151626..2286408 0.004	inside	Prophage	-	-	2151085..2311344	160259
	Similar MGE(s) Similar MGE(s) is defined as other TA-related MGE(s) with Mash distance < 0.01 to this MGE. Detail Genome accession Organism MGE type Related TA Coordinates Mash distance View NC_000964 Bacillus subtilis subsp. subtilis str. 168 Prophage TA006323, TA006321, TA06323b, TA020252 2151626..2286408 0	inside	Prophage	-	-	2151085..2285867	134782

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

No domain identified.

Sequences

Toxin

Protein

• Length: 84 a.a.
• Molecular weight: 9956.96 Da
• Isoelectric Point: 9.7930

>T256649 WP_010886546.1 NZ_CP103783:c2219224-2218973 [Bacillus subtilis subsp. subtilis str. 168]
MNFSFSSYPYYNMIKHIANMKRFSLWFTHITFIGLFLMFQLIKDYFSSEGQALINTIFVVTCIIAILLWIIYCVFLKLRN
KSH

Nucleotide

• Length: 252 bp

Antitoxin

Nucleotide

• Length: 101 bp

>AT256649 NZ_CP103783:2219360-2219460 [Bacillus subtilis subsp. subtilis str. 168]
GATTGTAAGAACCGTTAAAGATATGAGGAAAGCAACTACGATACCCATTTTCTCAAGCACTATGTACACCTCCTTTCCTA
TGACTCTATTATAACATAATT

Similar Proteins

Only experimentally validated proteins are listed.

Toxin

Loading, please wait

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
No matching records found

Showing 1 to 0 of 0 rows

10

rows per page

• ‹
• ›

Antitoxin

Loading, please wait

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
No matching records found

Showing 1 to 0 of 0 rows

10

rows per page

• ‹
• ›

Structures

Toxin

Loading, please wait

• AlphaFold DB: C0H439

Antitoxin