Detailed information of TA system TA254834

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): yonT-as-bsrG/-
• Location: 2219154..2219641
• Replicon: chromosome
• Accession: NZ_CP103066
• Organism: Bacillus subtilis strain 0137

Toxin (Protein)

• Gene name: yonT
• Uniprot ID: C0H439
• Locus tag: NXS96_RS11455
• Protein ID: WP_010886546.1
• Coordinates: 2219154..2219405 (-)
• Length: 84 a.a.

Antitoxin (RNA)

Gene name	as-bsrG
Locus tag	-
Coordinates	2219541..2219641 (+)

Genomic Context

Location: 2219541..2219641 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 2219541..2219641 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 2219541..2219641 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 2219541..2219641 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_2

Location: 2221980..2222174 (195 bp)
Type: Others
Protein ID: WP_004399291.1

Location: 2214611..2214838 (228 bp)
Type: Others
Protein ID: WP_004399298.1

Location: 2215099..2216415 (1317 bp)
Type: Others
Protein ID: WP_004399369.1

Location: 2216772..2217278 (507 bp)
Type: Others
Protein ID: WP_004399486.1

Location: 2217607..2218839 (1233 bp)
Type: Others
Protein ID: WP_004399445.1

Location: 2218921..2219109 (189 bp)
Type: Others
Protein ID: WP_004399547.1

Location: 2219154..2219405 (252 bp)
Type: Toxin
Protein ID: WP_010886546.1

Location: 2219424..2219600 (177 bp)
Type: Others
Protein ID: WP_009967515.1

Location: 2219975..2220586 (612 bp)
Type: Others
Protein ID: WP_009967516.1

Location: 2220701..2221027 (327 bp)
Type: Others
Protein ID: WP_009967517.1

Loading, please wait

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
NXS96_RS11430 (2214611)	2214611..2214838	-	228	WP_004399298.1	helix-turn-helix transcriptional regulator	-
NXS96_RS11435 (2215099)	2215099..2216415	-	1317	WP_004399369.1	hypothetical protein	-
NXS96_RS11440 (2216772)	2216772..2217278	-	507	WP_004399486.1	hypothetical protein	-
NXS96_RS11445 (2217607)	2217607..2218839	-	1233	WP_004399445.1	hypothetical protein	-
NXS96_RS11450 (2218921)	2218921..2219109	-	189	WP_004399547.1	hypothetical protein	-
NXS96_RS11455 (2219154)	2219154..2219405	-	252	WP_010886546.1	hypothetical protein	Toxin
NXS96_RS11460 (2219424)	2219424..2219600	-	177	WP_009967515.1	hypothetical protein	-
- (2219541)	2219541..2219641	+	101	NuclAT_2	-	Antitoxin
- (2219541)	2219541..2219641	+	101	NuclAT_2	-	Antitoxin
- (2219541)	2219541..2219641	+	101	NuclAT_2	-	Antitoxin
- (2219541)	2219541..2219641	+	101	NuclAT_2	-	Antitoxin
NXS96_RS11465 (2219975)	2219975..2220586	-	612	WP_009967516.1	lipoprotein	-
NXS96_RS11470 (2220701)	2220701..2221027	-	327	WP_009967517.1	helix-turn-helix transcriptional regulator	-
NXS96_RS11475 (2221980)	2221980..2222174	+	195	WP_004399291.1	hypothetical protein	-

Associated MGEs

Loading, please wait

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	Similar MGE(s) Similar MGE(s) is defined as other TA-related MGE(s) with Mash distance < 0.01 to this MGE. Detail Genome accession Organism MGE type Related TA Coordinates Mash distance View NC_000964 Bacillus subtilis subsp. subtilis str. 168 Prophage TA006323, TA006321, TA06323b, TA020252 2151626..2286408 0	inside	Prophage	-	-	2151265..2286041	134776

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

No domain identified.

Sequences

Toxin

Protein

• Length: 84 a.a.
• Molecular weight: 9956.96 Da
• Isoelectric Point: 9.7930

>T254834 WP_010886546.1 NZ_CP103066:c2219405-2219154 [Bacillus subtilis]
MNFSFSSYPYYNMIKHIANMKRFSLWFTHITFIGLFLMFQLIKDYFSSEGQALINTIFVVTCIIAILLWIIYCVFLKLRN
KSH

Nucleotide

• Length: 252 bp

Antitoxin

Nucleotide

• Length: 101 bp

>AT254834 NZ_CP103066:2219541-2219641 [Bacillus subtilis]
GATTGTAAGAACCGTTAAAGATATGAGGAAAGCAACTACGATACCCATTTTCTCAAGCACTATGTACACCTCCTTTCCTA
TGACTCTATTATAACATAATT

Similar Proteins

Only experimentally validated proteins are listed.

Toxin

Loading, please wait

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
No matching records found

Showing 1 to 0 of 0 rows

10

rows per page

• ‹
• ›

Antitoxin

Loading, please wait

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
No matching records found

Showing 1 to 0 of 0 rows

10

rows per page

• ‹
• ›

Structures

Toxin

Loading, please wait

• AlphaFold DB: C0H439

Antitoxin