Detailed information of TA system TA253026

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): yonT-as-bsrE/-
• Location: 2198613..2199100
• Replicon: chromosome
• Accession: NZ_CP101937
• Organism: Bacillus subtilis strain RUB331

Toxin (Protein)

• Gene name: yonT
• Uniprot ID: C0H439
• Locus tag: NP435_RS11310
• Protein ID: WP_010886546.1
• Coordinates: 2198613..2198864 (-)
• Length: 84 a.a.

Antitoxin (RNA)

Gene name	as-bsrE
Locus tag	-
Coordinates	2199000..2199100 (+)

Genomic Context

Location: 2199000..2199100 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_1

Location: 2199000..2199100 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_1

Location: 2199000..2199100 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_1

Location: 2199000..2199100 (101 bp)
Type: Antitoxin
Protein ID: NuclAT_1

Location: 2201439..2201633 (195 bp)
Type: Others
Protein ID: WP_004399291.1

Location: 2194071..2194298 (228 bp)
Type: Others
Protein ID: WP_004399298.1

Location: 2194559..2195875 (1317 bp)
Type: Others
Protein ID: WP_004399369.1

Location: 2196232..2196738 (507 bp)
Type: Others
Protein ID: WP_004399486.1

Location: 2197066..2198298 (1233 bp)
Type: Others
Protein ID: WP_004399445.1

Location: 2198380..2198568 (189 bp)
Type: Others
Protein ID: WP_004399547.1

Location: 2198613..2198864 (252 bp)
Type: Toxin
Protein ID: WP_010886546.1

Location: 2198883..2199059 (177 bp)
Type: Others
Protein ID: WP_009967515.1

Location: 2199434..2200045 (612 bp)
Type: Others
Protein ID: WP_009967516.1

Location: 2200160..2200486 (327 bp)
Type: Others
Protein ID: WP_009967517.1

Loading, please wait

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
NP435_RS11285 (2194071)	2194071..2194298	-	228	WP_004399298.1	helix-turn-helix transcriptional regulator	-
NP435_RS11290 (2194559)	2194559..2195875	-	1317	WP_004399369.1	hypothetical protein	-
NP435_RS11295 (2196232)	2196232..2196738	-	507	WP_004399486.1	hypothetical protein	-
NP435_RS11300 (2197066)	2197066..2198298	-	1233	WP_004399445.1	hypothetical protein	-
NP435_RS11305 (2198380)	2198380..2198568	-	189	WP_004399547.1	hypothetical protein	-
NP435_RS11310 (2198613)	2198613..2198864	-	252	WP_010886546.1	hypothetical protein	Toxin
NP435_RS11315 (2198883)	2198883..2199059	-	177	WP_009967515.1	hypothetical protein	-
- (2199000)	2199000..2199100	+	101	NuclAT_1	-	Antitoxin
- (2199000)	2199000..2199100	+	101	NuclAT_1	-	Antitoxin
- (2199000)	2199000..2199100	+	101	NuclAT_1	-	Antitoxin
- (2199000)	2199000..2199100	+	101	NuclAT_1	-	Antitoxin
NP435_RS11320 (2199434)	2199434..2200045	-	612	WP_009967516.1	lipoprotein	-
NP435_RS11325 (2200160)	2200160..2200486	-	327	WP_009967517.1	helix-turn-helix transcriptional regulator	-
NP435_RS11330 (2201439)	2201439..2201633	+	195	WP_004399291.1	hypothetical protein	-

Associated MGEs

Loading, please wait

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	Similar MGE(s) Similar MGE(s) is defined as other TA-related MGE(s) with Mash distance < 0.01 to this MGE. Detail Genome accession Organism MGE type Related TA Coordinates Mash distance View NC_000964 Bacillus subtilis subsp. subtilis str. 168 Prophage TA006323, TA006321, TA06323b, TA020252 2151626..2286408 0	inside	Prophage	-	-	2130725..2265507	134782

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

No domain identified.

Sequences

Toxin

Protein

• Length: 84 a.a.
• Molecular weight: 9956.96 Da
• Isoelectric Point: 9.7930

>T253026 WP_010886546.1 NZ_CP101937:c2198864-2198613 [Bacillus subtilis]
MNFSFSSYPYYNMIKHIANMKRFSLWFTHITFIGLFLMFQLIKDYFSSEGQALINTIFVVTCIIAILLWIIYCVFLKLRN
KSH

Nucleotide

• Length: 252 bp

Antitoxin

Nucleotide

• Length: 101 bp

>AT253026 NZ_CP101937:2199000-2199100 [Bacillus subtilis]
GATTGTAAGAACCGTTAAAGATATGAGGAAAGCAACTACGATACCCATTTTCTCAAGCACTATGTACACCTCCTTTCCTA
TGACTCTATTATAACATAATT

Similar Proteins

Only experimentally validated proteins are listed.

Toxin

Loading, please wait

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
No matching records found

Showing 1 to 0 of 0 rows

10

rows per page

• ‹
• ›

Antitoxin

Loading, please wait

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
No matching records found

Showing 1 to 0 of 0 rows

10

rows per page

• ‹
• ›

Structures

Toxin

Loading, please wait

• AlphaFold DB: C0H439

Antitoxin