Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   AAHT64_RS18400 Genome accession   NZ_CP155054
Coordinates   3551031..3551153 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain R38     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3546031..3556153
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AAHT64_RS18370 (AAHT64_18370) yclP 3546102..3546860 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  AAHT64_RS18375 (AAHT64_18375) yclO 3546854..3547801 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  AAHT64_RS18380 (AAHT64_18380) ceuB 3547794..3548744 (-) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  AAHT64_RS18385 (AAHT64_18385) thrD 3549129..3550493 (+) 1365 WP_003234493.1 aspartate kinase -
  AAHT64_RS18390 (AAHT64_18390) yczN 3550647..3550760 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  AAHT64_RS18395 (AAHT64_18395) yczM 3550842..3550931 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  AAHT64_RS18400 (AAHT64_18400) phrC 3551031..3551153 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  AAHT64_RS18405 (AAHT64_18405) rapC 3551137..3552285 (-) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  AAHT64_RS18410 (AAHT64_18410) yclK 3552448..3553869 (-) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  AAHT64_RS18415 (AAHT64_18415) yclJ 3553856..3554539 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=995884 AAHT64_RS18400 WP_003224994.1 3551031..3551153(-) (phrC) [Bacillus subtilis subsp. subtilis strain R38]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=995884 AAHT64_RS18400 WP_003224994.1 3551031..3551153(-) (phrC) [Bacillus subtilis subsp. subtilis strain R38]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment