Detailed information NTG0098697

Bioinformatically predicted

Overview

• Name: comGE/cglE
• Type: Machinery gene
• Locus tag: R8615_RS09680
• Genome accession: NZ_AP026929
• Coordinates: 1876735..1877037 (-)
• Length: 100 a.a.
• NCBI ID: WP_000413382.1
• Uniprot ID: -
• Organism: Streptococcus pneumoniae strain PZ900701114
• Function: dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1871735..1882037

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
R8615_RS09645 (PC1101_18860)	rnpA	1872422..1872793 (-)	372	WP_000739247.1	ribonuclease P protein component	-
R8615_RS09650	-	1872810..1872941 (-)	132	WP_000768904.1	hypothetical protein	-
R8615_RS09655 (PC1101_18870)	-	1872942..1874132 (-)	1191	WP_000167765.1	acetate kinase	-
R8615_RS09660 (PC1101_18880)	comYH	1874183..1875136 (-)	954	WP_000345122.1	class I SAM-dependent methyltransferase	Machinery gene
R8615_RS09665 (PC1101_18890)	-	1875197..1875784 (-)	588	WP_000679779.1	class I SAM-dependent methyltransferase	-
R8615_RS09670 (PC1101_18900)	comGG/cglG	1875887..1876333 (-)	447	WP_001811371.1	competence type IV pilus minor pilin ComGG	Machinery gene
R8615_RS09675 (PC1101_18910)	comGF/cglF	1876311..1876772 (-)	462	WP_000250539.1	competence type IV pilus minor pilin ComGF	Machinery gene
R8615_RS09680 (PC1101_18920)	comGE/cglE	1876735..1877037 (-)	303	WP_000413382.1	competence type IV pilus minor pilin ComGE	Machinery gene
R8615_RS09685 (PC1101_18930)	comGD/cglD	1877000..1877404 (-)	405	WP_000588030.1	competence type IV pilus minor pilin ComGD	Machinery gene
R8615_RS09690 (PC1101_18940)	comGC/cglC	1877397..1877723 (-)	327	WP_000738625.1	competence type IV pilus major pilin ComGC	Machinery gene
R8615_RS09695 (PC1101_18950)	comGB/cglB	1877725..1878741 (-)	1017	WP_074017570.1	competence type IV pilus assembly protein ComGB	Machinery gene
R8615_RS09700 (PC1101_18960)	comGA/cglA/cilD	1878689..1879630 (-)	942	WP_000249555.1	competence type IV pilus ATPase ComGA	Machinery gene
R8615_RS09705 (PC1101_18970)	-	1879705..1880070 (-)	366	WP_000286415.1	DUF1033 family protein	-
R8615_RS09710 (PC1101_18980)	-	1880217..1881275 (-)	1059	WP_000649471.1	zinc-dependent alcohol dehydrogenase family protein	-

Sequence

Protein

• Length: 100 a.a.
• Molecular weight: 11108.08 Da
• Isoelectric Point: 9.7273

>NTDB_id=98697 R8615_RS09680 WP_000413382.1 1876735..1877037(-) (comGE/cglE) [Streptococcus pneumoniae strain PZ900701114]
MEKLNALRKQKIRAVILLEAVVALAIFASIATLLLGQIQKNRQEEAKILQKEEVLRVAKMALQTGQNQVSINGVEIQVFS
SEKGLEVYHGSEQLLAIKEP

Nucleotide

• Length: 303 bp

>NTDB_id=98697 R8615_RS09680 WP_000413382.1 1876735..1877037(-) (comGE/cglE) [Streptococcus pneumoniae strain PZ900701114]
ATGGAAAAATTAAACGCATTAAGGAAACAAAAAATTAGGGCAGTGATTTTACTGGAAGCAGTAGTCGCTCTAGCTATCTT
TGCCAGCATTGCGACCCTCCTTTTGGGACAAATTCAAAAAAATAGGCAAGAGGAAGCAAAAATCTTGCAAAAGGAAGAAG
TCTTGAGGGTAGCTAAGATGGCCCTGCAGACGGGGCAAAATCAGGTAAGCATCAACGGAGTTGAGATTCAGGTATTTTCT
AGTGAAAAAGGATTGGAGGTCTACCATGGTTCAGAACAGTTGTTGGCAATCAAAGAGCCATAA

Domains

Predicted by InterproScan.

• Type II secretory pathway pseudopilin (ComGE) (16-97)

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
comGE/cglE	Streptococcus pneumoniae Rx1	100	100	1
comGE/cglE	Streptococcus pneumoniae D39	100	100	1
comGE/cglE	Streptococcus pneumoniae R6	100	100	1
comGE/cglE	Streptococcus pneumoniae TIGR4	100	100	1
comGE/cglE	Streptococcus mitis NCTC 12261	98	100	0.98
comGE/cglE	Streptococcus mitis SK321	98	100	0.98
comYE	Streptococcus mutans UA140	44.444	90	0.4
comYE	Streptococcus mutans UA159	44.444	90	0.4