Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   NYE53_RS02165 Genome accession   NZ_CP150251
Coordinates   426796..426918 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. FSL R5-0523     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 421796..431918
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NYE53_RS02150 (NYE53_02150) yclJ 423411..424094 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  NYE53_RS02155 (NYE53_02155) yclK 424081..425502 (+) 1422 WP_339247008.1 two-component system sensor histidine kinase YclK -
  NYE53_RS02160 (NYE53_02160) rapC 425664..426812 (+) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  NYE53_RS02165 (NYE53_02165) phrC 426796..426918 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NYE53_RS02170 (NYE53_02170) - 427018..427107 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NYE53_RS02175 (NYE53_02175) - 427188..427301 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  NYE53_RS02180 (NYE53_02180) - 427454..428818 (-) 1365 WP_339247010.1 aspartate kinase -
  NYE53_RS02185 (NYE53_02185) ceuB 429203..430153 (+) 951 WP_088325307.1 petrobactin ABC transporter permease YclN Machinery gene
  NYE53_RS02190 (NYE53_02190) yclO 430146..431093 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  NYE53_RS02195 (NYE53_02195) yclP 431087..431845 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=967771 NYE53_RS02165 WP_003224994.1 426796..426918(+) (phrC) [Bacillus sp. FSL R5-0523]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=967771 NYE53_RS02165 WP_003224994.1 426796..426918(+) (phrC) [Bacillus sp. FSL R5-0523]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment