Detailed information
Overview
| Name | sinI | Type | Regulator |
| Locus tag | NSU16_RS12175 | Genome accession | NZ_CP150176 |
| Coordinates | 2398480..2398653 (+) | Length | 57 a.a. |
| NCBI ID | WP_339190978.1 | Uniprot ID | - |
| Organism | Bacillus sp. FSL K6-1003 | ||
| Function | inhibit the expression of sinR (predicted from homology) Competence regulation |
||
Genomic Context
Location: 2393480..2403653
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NSU16_RS12160 (NSU16_12160) | gcvT | 2394281..2395369 (-) | 1089 | WP_339190972.1 | glycine cleavage system aminomethyltransferase GcvT | - |
| NSU16_RS12165 (NSU16_12165) | - | 2395812..2397485 (+) | 1674 | WP_268504993.1 | SNF2-related protein | - |
| NSU16_RS12170 (NSU16_12170) | - | 2397506..2398300 (+) | 795 | WP_339190975.1 | YqhG family protein | - |
| NSU16_RS12175 (NSU16_12175) | sinI | 2398480..2398653 (+) | 174 | WP_339190978.1 | anti-repressor SinI family protein | Regulator |
| NSU16_RS12180 (NSU16_12180) | sinR | 2398687..2399022 (+) | 336 | WP_003226345.1 | transcriptional regulator SinR | Regulator |
| NSU16_RS12185 (NSU16_12185) | tasA | 2399110..2399895 (-) | 786 | WP_168748227.1 | biofilm matrix protein TasA | - |
| NSU16_RS12190 (NSU16_12190) | - | 2399960..2400544 (-) | 585 | WP_339190980.1 | signal peptidase I | - |
| NSU16_RS12195 (NSU16_12195) | tapA | 2400516..2401277 (-) | 762 | WP_339190983.1 | amyloid fiber anchoring/assembly protein TapA | - |
| NSU16_RS12200 (NSU16_12200) | - | 2401554..2401877 (+) | 324 | WP_168748230.1 | YqzG/YhdC family protein | - |
| NSU16_RS12205 (NSU16_12205) | - | 2401920..2402099 (-) | 180 | WP_003236949.1 | YqzE family protein | - |
| NSU16_RS12210 (NSU16_12210) | comGG | 2402171..2402545 (-) | 375 | WP_286058321.1 | competence type IV pilus minor pilin ComGG | Machinery gene |
| NSU16_RS12215 (NSU16_12215) | comGF | 2402546..2402929 (-) | 384 | WP_026014740.1 | competence type IV pilus minor pilin ComGF | Machinery gene |
| NSU16_RS12220 (NSU16_12220) | comGE | 2402955..2403302 (-) | 348 | WP_168748233.1 | competence type IV pilus minor pilin ComGE | Machinery gene |
Sequence
Protein
Download Length: 57 a.a. Molecular weight: 6669.59 Da Isoelectric Point: 6.4604
>NTDB_id=965003 NSU16_RS12175 WP_339190978.1 2398480..2398653(+) (sinI) [Bacillus sp. FSL K6-1003]
MKNAKQEHFELDQEWVELMLEAREANISPEEIRKYLLLNKKSAYPGPAARSHTVNPF
MKNAKQEHFELDQEWVELMLEAREANISPEEIRKYLLLNKKSAYPGPAARSHTVNPF
Nucleotide
Download Length: 174 bp
>NTDB_id=965003 NSU16_RS12175 WP_339190978.1 2398480..2398653(+) (sinI) [Bacillus sp. FSL K6-1003]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTGGATCAAGAATGGGTTGAATTAATGCTGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTTATCCTGGTCCGGCAGCCAGAAGTCATACCG
TAAATCCTTTCTGA
ATGAAAAATGCAAAACAAGAGCACTTCGAATTGGATCAAGAATGGGTTGAATTAATGCTGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTTATCCTGGTCCGGCAGCCAGAAGTCATACCG
TAAATCCTTTCTGA
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| sinI | Bacillus subtilis subsp. subtilis str. 168 |
94.737 |
100 |
0.947 |