Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   NSS75_RS13130 Genome accession   NZ_CP150175
Coordinates   2553110..2553283 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus sp. FSL K6-1012     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2548110..2558283
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NSS75_RS13115 (NSS75_13115) gcvT 2548907..2549995 (-) 1089 WP_101861031.1 glycine cleavage system aminomethyltransferase GcvT -
  NSS75_RS13120 (NSS75_13120) - 2550439..2552112 (+) 1674 WP_101861177.1 SNF2-related protein -
  NSS75_RS13125 (NSS75_13125) - 2552132..2552926 (+) 795 WP_101861032.1 YqhG family protein -
  NSS75_RS13130 (NSS75_13130) sinI 2553110..2553283 (+) 174 WP_024122036.1 anti-repressor SinI family protein Regulator
  NSS75_RS13135 (NSS75_13135) sinR 2553317..2553652 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  NSS75_RS13140 (NSS75_13140) tasA 2553739..2554524 (-) 786 WP_024122037.1 biofilm matrix protein TasA -
  NSS75_RS13145 (NSS75_13145) - 2554589..2555173 (-) 585 WP_268496720.1 signal peptidase I -
  NSS75_RS13150 (NSS75_13150) tapA 2555145..2555906 (-) 762 WP_101861034.1 amyloid fiber anchoring/assembly protein TapA -
  NSS75_RS13155 (NSS75_13155) - 2556183..2556506 (+) 324 WP_024122040.1 YqzG/YhdC family protein -
  NSS75_RS13160 (NSS75_13160) - 2556549..2556728 (-) 180 WP_101861035.1 YqzE family protein -
  NSS75_RS13165 (NSS75_13165) comGG 2556800..2557174 (-) 375 WP_059335411.1 competence type IV pilus minor pilin ComGG Machinery gene
  NSS75_RS13170 (NSS75_13170) comGF 2557175..2557558 (-) 384 WP_038954226.1 competence type IV pilus minor pilin ComGF Machinery gene
  NSS75_RS13175 (NSS75_13175) comGE 2557584..2557931 (-) 348 WP_339233339.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=964922 NSS75_RS13130 WP_024122036.1 2553110..2553283(+) (sinI) [Bacillus sp. FSL K6-1012]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=964922 NSS75_RS13130 WP_024122036.1 2553110..2553283(+) (sinI) [Bacillus sp. FSL K6-1012]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947

Multiple sequence alignment