Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NSS75_RS02490 Genome accession   NZ_CP150175
Coordinates   479981..480103 (+) Length   40 a.a.
NCBI ID   WP_024120213.1    Uniprot ID   A0A9Q6A750
Organism   Bacillus sp. FSL K6-1012     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 474981..485103
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NSS75_RS02475 (NSS75_02475) - 476586..477269 (+) 684 WP_103671924.1 response regulator transcription factor -
  NSS75_RS02480 (NSS75_02480) - 477256..478680 (+) 1425 WP_213418306.1 HAMP domain-containing sensor histidine kinase -
  NSS75_RS02485 (NSS75_02485) rapC 478849..479997 (+) 1149 WP_339235722.1 response regulator aspartate phosphatase RapC Regulator
  NSS75_RS02490 (NSS75_02490) phrC 479981..480103 (+) 123 WP_024120213.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  NSS75_RS02495 (NSS75_02495) - 480208..480300 (-) 93 WP_024120214.1 YjcZ family sporulation protein -
  NSS75_RS02500 (NSS75_02500) - 480447..480557 (-) 111 WP_024120215.1 YjcZ family sporulation protein -
  NSS75_RS02505 (NSS75_02505) - 480708..482072 (-) 1365 WP_101860981.1 aspartate kinase -
  NSS75_RS02510 (NSS75_02510) ceuB 482458..483408 (+) 951 WP_010333025.1 petrobactin ABC transporter permease YclN Machinery gene
  NSS75_RS02515 (NSS75_02515) yclO 483401..484348 (+) 948 WP_024120217.1 petrobactin ABC transporter permease YclO -
  NSS75_RS02520 (NSS75_02520) yclP 484342..485100 (+) 759 WP_024120218.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4267.00 Da        Isoelectric Point: 7.1634

>NTDB_id=964891 NSS75_RS02490 WP_024120213.1 479981..480103(+) (phrC) [Bacillus sp. FSL K6-1012]
MKLKSKLFVICLAAAAVFTAVGVSEHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=964891 NSS75_RS02490 WP_024120213.1 479981..480103(+) (phrC) [Bacillus sp. FSL K6-1012]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGAACATGC
TGAAGCATCCGACTTTCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

87.5

100

0.875

Multiple sequence alignment