Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NSQ16_RS02150 Genome accession   NZ_CP150155
Coordinates   426220..426342 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. PS108     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 421220..431342
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NSQ16_RS02135 (NSQ16_02135) yclJ 422833..423516 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  NSQ16_RS02140 (NSQ16_02140) yclK 423503..424924 (+) 1422 WP_230488160.1 two-component system sensor histidine kinase YclK -
  NSQ16_RS02145 (NSQ16_02145) rapC 425088..426236 (+) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  NSQ16_RS02150 (NSQ16_02150) phrC 426220..426342 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NSQ16_RS02155 (NSQ16_02155) - 426442..426531 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NSQ16_RS02160 (NSQ16_02160) - 426613..426726 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  NSQ16_RS02165 (NSQ16_02165) - 426880..428244 (-) 1365 WP_230488159.1 aspartate kinase -
  NSQ16_RS02170 (NSQ16_02170) ceuB 428629..429579 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NSQ16_RS02175 (NSQ16_02175) yclO 429572..430519 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  NSQ16_RS02180 (NSQ16_02180) yclP 430513..431271 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=963632 NSQ16_RS02150 WP_003224994.1 426220..426342(+) (phrC) [Bacillus sp. PS108]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=963632 NSQ16_RS02150 WP_003224994.1 426220..426342(+) (phrC) [Bacillus sp. PS108]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1