Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   WHL51_RS02090 Genome accession   NZ_CP148102
Coordinates   416483..416605 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus spizizenii str. W23     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 411483..421605
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  WHL51_RS02075 yclJ 413098..413781 (+) 684 WP_003224983.1 two-component system response regulator YclJ -
  WHL51_RS02080 yclK 413768..415189 (+) 1422 WP_079996289.1 two-component system sensor histidine kinase YclK -
  WHL51_RS02085 rapC 415351..416499 (+) 1149 WP_003224987.1 response regulator aspartate phosphatase RapC Regulator
  WHL51_RS02090 phrC 416483..416605 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  WHL51_RS02095 - 416704..416811 (-) 108 WP_003224996.1 YjcZ family sporulation protein -
  WHL51_RS02100 - 416960..418324 (-) 1365 WP_003224998.1 aspartate kinase -
  WHL51_RS02105 ceuB 418709..419659 (+) 951 WP_003225000.1 petrobactin ABC transporter permease YclN Machinery gene
  WHL51_RS02110 yclO 419652..420599 (+) 948 WP_003225003.1 petrobactin ABC transporter permease YclO -
  WHL51_RS02115 yclP 420593..421351 (+) 759 WP_003225005.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=950401 WHL51_RS02090 WP_003224994.1 416483..416605(+) (phrC) [Bacillus spizizenii str. W23]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=950401 WHL51_RS02090 WP_003224994.1 416483..416605(+) (phrC) [Bacillus spizizenii str. W23]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAACGC
GGAAGCACTCGACTTTCATGTGACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1